Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2253 bp · LXL04_010604|LXL04_010604|OH1004|cDNA
ATGAATCGTCGTTTTACCTTTTTCTGTCACTCCATTCTAATAAACACTTCAAAGCCCGCACGAAAATTAGTTTCTATAAACCCTAGAACAAATGGGTTCTCGTTATTTAGAGCATTTATGTACACTTCAACACAATACAATTACAACAGCAACTATAGGAGACCTAATACCAATACAGACGCAAATGATCCTTCCACTCTCATGAAAGAAGATGGCGTCTCAGTCTGTTCGGAATTATGGATTGAGAGTTTCCGTAACCC...
2253 bp · LXL04_010604|LXL04_010604|OH1004|CDS
ATGAATCGTCGTTTTACCTTTTTCTGTCACTCCATTCTAATAAACACTTCAAAGCCCGCACGAAAATTAGTTTCTATAAACCCTAGAACAAATGGGTTCTCGTTATTTAGAGCATTTATGTACACTTCAACACAATACAATTACAACAGCAACTATAGGAGACCTAATACCAATACAGACGCAAATGATCCTTCCACTCTCATGAAAGAAGATGGCGTCTCAGTCTGTTCGGAATTATGGATTGAGAGTTTCCGTAACCC...
Protein
Download Protein FASTA750 aa · LXL04_010604|LXL04_010604|OH1004|PROTEIN
MNRRFTFFCHSILINTSKPARKLVSINPRTNGFSLFRAFMYTSTQYNYNSNYRRPNTNTDANDPSTLMKEDGVSVCSELWIESFRNPNQTITNLTNYLRRFELWVLAYQKVCADELGAYMPKSSVQRSALEDLLALRNAVLDNRFRWGARLEFFIKSPKDKTEYESLSKRKIRAILTTTQPSPFQDRIVQEVLFMILEPVYEARFSEKSYAFRPGRTPHTALRVIRRSFAGYLWYIKGDLSTILDGLKVGMVISALMRDV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_010604 |
|---|---|
| TK1151 ID | TkA05G056150 |
| OH-1004 ID | LXL04_010604 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 51.200 |
| Protein coverage (%) | TK1151 90.684 / OH-1004 82.400Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_010604 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:149589023-149592208 (+) | |||||||||
| Description | Similar to NMAT2: Nuclear intron maturase 2, mitochondrial | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000373 Group II intron splicing Biological Process GO:0000374 Group III intron splicing Biological Process GO:0006314 intron homing Biological Process GO:0006397 mRNA processing Biological Process GO:0006521 regulation of amino acid metabolic process Biological Process GO:0007005 mitochondrion organization Biological Process GO:0009845 seed germination Biological Process GO:0010228 vegetative to reproductive phase transition of meristem Biological Process GO:0010896 regulation of triglyceride catabolic process Biological Process GO:0032885 regulation of polysaccharide biosynthetic process Biological Process GO:0090351 seedling development Biological Process GO:0090615 mitochondrial mRNA processing Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G30010 ath:AT5G46920 llm:llmg_1371 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01348.27Intron_maturas2485-580 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_010604 | PF01348.27 | Intron_maturas2 | 485 | 580 | 9.5e-10 | 39.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.