LXL04_010071 | RubberDandelionOmics

Gene overview

LXL04_010071

Reference: OH-1004 Chr: Chr02 Coordinates: 139359417-139360643 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1227 bp · LXL04_010071|LXL04_010071|OH1004|cDNA

ATGGCTTCCATCACCAAGCTTCGATTACTAAACTCATGTAATCGTCAAAAGCTGTATTCCATATATCAAATTCAAGATCGACATTTTTCATCAATTCTAAACCCTGATTCCTCCACTCCCCTCTCCAGTAAAGAGAAATCACGAGCCGCTCTTTCTCTCCTCAAATTCGAGAAAAACCCAGAACGAATTATTGAAATCTGCCGGGCTGCTTCACTGACGCCGGATTCTCATCTCGACCGCGTTGCCTTTTCGACCGCCAT...

CDS

Download CDS FASTA

1227 bp · LXL04_010071|LXL04_010071|OH1004|CDS

ATGGCTTCCATCACCAAGCTTCGATTACTAAACTCATGTAATCGTCAAAAGCTGTATTCCATATATCAAATTCAAGATCGACATTTTTCATCAATTCTAAACCCTGATTCCTCCACTCCCCTCTCCAGTAAAGAGAAATCACGAGCCGCTCTTTCTCTCCTCAAATTCGAGAAAAACCCAGAACGAATTATTGAAATCTGCCGGGCTGCTTCACTGACGCCGGATTCTCATCTCGACCGCGTTGCCTTTTCGACCGCCAT...

Protein

Download Protein FASTA

408 aa · LXL04_010071|LXL04_010071|OH1004|PROTEIN

MASITKLRLLNSCNRQKLYSIYQIQDRHFSSILNPDSSTPLSSKEKSRAALSLLKFEKNPERIIEICRAASLTPDSHLDRVAFSTAISKLTELNYFEGIRNFIDELFKTRPDLNTEKFICNAITYYGQAGLLTNAFQLFDKMPQLGAVQNAKSLNALLFSCMLAKKYDEAKRVYLDFPPKYGIKPNLDTYNTMIKSFCESGSSSSCYSVTAEMMRKKCKPNATTFGTMIAGFYKEEKFEDVGKVLEMMKKHEVPITLGIY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010071`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010071

Location Chr02:139359417-139360643 (+)

Description Similar to PPR336: Pentatricopeptide repeat-containing protein At1g61870, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61870`	May be involved in translation through its association with polysomes.	No verified direct reference in this release
`At1g11630`	Pentatricopeptide repeat-containing protein At1g11630, mitochondrial.	No verified direct reference in this release
`At1g55890`	Small ribosomal subunit protein mS78 (rPPR3a).	No verified direct reference in this release
`At3g13160`	Small ribosomal subunit protein mS79 (rPPR3b).	No verified direct reference in this release
`At4g36680`	Small ribosomal subunit protein mL103 (rPPR7).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010071 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G11630

ath:AT1G55890

ath:AT1G61870

ath:AT3G13160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.883

Rank 1 · LXL04_010071 · OH-1004

Plastid0.066

Rank 2 · LXL04_010071 · OH-1004

Nucleus0.050

Rank 3 · LXL04_010071 · OH-1004

Cytoplasm0.035

Rank 4 · LXL04_010071 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_010071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29070.1MSC6_N82-201 aa

PF17177.11PPR_long131-218 aa

PF13812.13PPR_3138-197 aa

PF13041.13PPR_2152-198 aa

PF29070.1MSC6_N165-246 aa

PF12854.14PPR_1182-201 aa

PF13041.13PPR_2185-234 aa

PF01535.27PPR189-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010071	`PF29070.1`	MSC6_N	82	201	3.3e-21	76.5
LXL04_010071	`PF17177.11`	PPR_long	131	218	4.4e-13	49.8
LXL04_010071	`PF13812.13`	PPR_3	138	197	7.9e-24	84.2
LXL04_010071	`PF13041.13`	PPR_2	152	198	5.9e-41	139.1
LXL04_010071	`PF29070.1`	MSC6_N	165	246	3.3e-21	76.5
LXL04_010071	`PF12854.14`	PPR_1	182	201	2.8e-39	133.2
LXL04_010071	`PF13041.13`	PPR_2	185	234	5.9e-41	139.1
LXL04_010071	`PF01535.27`	PPR	189	218	3.1e-34	115.5
LXL04_010071	`PF29070.1`	MSC6_N	206	352	3.3e-21	76.5
LXL04_010071	`PF13041.13`	PPR_2	259	296	5.9e-41	139.1
LXL04_010071	`PF29070.1`	MSC6_N	264	385	3.3e-21	76.5
LXL04_010071	`PF13812.13`	PPR_3	280	330	7.9e-24	84.2
LXL04_010071	`PF12854.14`	PPR_1	286	318	2.8e-39	133.2
LXL04_010071	`PF13041.13`	PPR_2	290	339	5.9e-41	139.1
LXL04_010071	`PF01535.27`	PPR	293	323	3.1e-34	115.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LE47`	Arabidopsis thaliana	Small ribosomal subunit protein mS86 (rPPR1)	56.724%	Swiss-Prot	strong database homology
`Q9SAB4`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g11630, mitochondrial	53.439%	Swiss-Prot	strong database homology
`Q9LG23`	Arabidopsis thaliana	Small ribosomal subunit protein mS78 (rPPR3a)	28.177%	Swiss-Prot	weak database homology
`Q9LK57`	Arabidopsis thaliana	Small ribosomal subunit protein mS79 (rPPR3b)	28.065%	Swiss-Prot	weak database homology
`Q9M065`	Arabidopsis thaliana	Small ribosomal subunit protein mL103 (rPPR7)	29.948%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card