LXL04_008743 | RubberDandelionOmics

Gene overview

LXL04_008743

Reference: OH-1004 Chr: Chr02 Coordinates: 107595102-107598930 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2805 bp · LXL04_008743|LXL04_008743|OH1004|cDNA

ATGAAAATCAGATCAATGAAACTACGGGAGGCTCACAAGAACAATGGTGGAAGCTCCTACTGTACCATCCTGTGGGACCTCACTGCGGAGCACATCGTCACCGCTTCTTCTTCCGACGCCTCCATTTCCATTCACGATGCTCTTTTAACTTCAAATACTCCACGAATTCTTCGGAATCATAGAGATGGAGTCACCACTTTGGCTCTCAGCCCTAATTCAACATGCCTAGCTTCTGGATCTAATGACCGCTCCGTCAAACT...

CDS

Download CDS FASTA

2805 bp · LXL04_008743|LXL04_008743|OH1004|CDS

ATGAAAATCAGATCAATGAAACTACGGGAGGCTCACAAGAACAATGGTGGAAGCTCCTACTGTACCATCCTGTGGGACCTCACTGCGGAGCACATCGTCACCGCTTCTTCTTCCGACGCCTCCATTTCCATTCACGATGCTCTTTTAACTTCAAATACTCCACGAATTCTTCGGAATCATAGAGATGGAGTCACCACTTTGGCTCTCAGCCCTAATTCAACATGCCTAGCTTCTGGATCTAATGACCGCTCCGTCAAACT...

Protein

Download Protein FASTA

934 aa · LXL04_008743|LXL04_008743|OH1004|PROTEIN

MKIRSMKLREAHKNNGGSSYCTILWDLTAEHIVTASSSDASISIHDALLTSNTPRILRNHRDGVTTLALSPNSTCLASGSNDRSVKLYKFPGKMSINFISSGGEFESNITRFTLPIRALSFNRSGTMLAAGGDDDGIKLINTIDGSVARVLKGHRGSITSISFDPKSEYLASVDSLGTVTIWELQSGTTIHTLKNISPPTPPDFTTLTALGWSPDGEILAVSGFKNDVVMYDRDTAEKLFTLRGDHTQPVCFLTFSVNGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008743`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008743

Location Chr02:107595102-107598930 (+)

Description Similar to wdhd1: WD repeat and HMG-box DNA-binding protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42660`	Participates in maintaining the H3K27me3 mark at target genes by interacting with LHP1-PRC2 complexes during replication, thus contributing to H3K27me3 inheritance.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008743 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006335 DNA replication-dependent chromatin assembly Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006396 RNA processing Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009733 response to auxin Biological Process

GO:0033044 regulation of chromosome organization Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0140462 pericentric heterochromatin organization Biological Process

GO:1903461 Okazaki fragment processing involved in mitotic DNA replication Biological Process

KEGG gene cross-reference

ath:AT3G42660

hsa:11169

mmu:218973

spo:2543387

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.949

Rank 1 · LXL04_008743 · OH-1004

Cytoplasm0.126

Rank 2 · LXL04_008743 · OH-1004

Cell membrane0.019

Rank 3 · LXL04_008743 · OH-1004

Mitochondrion0.012

Rank 4 · LXL04_008743 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_008743 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25174.2Beta-prop_THOC34-145 aa

PF25391.2WD40_Gbeta11-140 aa

PF24807.2WD40_CDC20-Fz18-147 aa

PF25173.2Beta-prop_WDR3_1st22-88 aa

PF23381.2Beta-prop_IFT122_1st28-94 aa

PF24817.2WD40_WDHD1_1st30-93 aa

PF25047.1Beta-prop_TEP1_2nd31-192 aa

PF25175.2Beta-prop_WDR532-195 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008743	`PF25174.2`	Beta-prop_THOC3	4	145	6.5e-38	131.0
LXL04_008743	`PF25391.2`	WD40_Gbeta	11	140	3.8e-10	40.0
LXL04_008743	`PF24807.2`	WD40_CDC20-Fz	18	147	3.9e-30	105.9
LXL04_008743	`PF25173.2`	Beta-prop_WDR3_1st	22	88	1.5e-32	113.5
LXL04_008743	`PF23381.2`	Beta-prop_IFT122_1st	28	94	2.5e-41	142.5
LXL04_008743	`PF24817.2`	WD40_WDHD1_1st	30	93	4.9e-65	220.3
LXL04_008743	`PF25047.1`	Beta-prop_TEP1_2nd	31	192	2.9e-17	63.4
LXL04_008743	`PF25175.2`	Beta-prop_WDR5	32	195	1.1e-37	130.6
LXL04_008743	`PF24814.2`	WD40_Prp19	32	134	3.1e-33	115.8
LXL04_008743	`PF24782.3`	WD40_MABP1-WDR62_2nd	34	184	1.2e-10	41.6
LXL04_008743	`PF00400.39`	WD40	55	88	8.4e-32	109.0
LXL04_008743	`PF23409.2`	Beta-prop_EML	58	289	5.6e-12	46.4
LXL04_008743	`PF24796.2`	WDR55	61	195	3.8e-15	56.4
LXL04_008743	`PF24817.2`	WD40_WDHD1_1st	102	314	4.9e-65	220.3
LXL04_008743	`PF24814.2`	WD40_Prp19	103	306	3.1e-33	115.8
LXL04_008743	`PF25168.2`	Beta-prop_WDR36-Utp21_2nd	108	222	9.2e-22	78.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JF14`	Arabidopsis thaliana	Protein ENHANCER OF LHP1 1	55.751%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card