LXL04_008538 | RubberDandelionOmics

Gene overview

LXL04_008538

Reference: OH-1004 Chr: Chr02 Coordinates: 102148073-102150399 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1281 bp · LXL04_008538|LXL04_008538|OH1004|cDNA

CTCCACCATCACCGCCACAACTACATCAGAATGAACCACCAACCCTTACTGGATTCCTCCGCCACTTCCCTCTCCGCCAAATCCTGGCTAGACGACGCCTGCATTGTAGACATCGACTGCTTCGTCAAAACCCTTTCCGGCATCAAAGCCAACGGTGTCCGCCCGGACCTCATTGGGTCTATCATCACACATTACGCTTCCAAATGGATTCCCGAACTCTCCGGCGAATCACCACCCCCTGTCGCCACCGAGCCCCAGTC...

CDS

Download CDS FASTA

1251 bp · LXL04_008538|LXL04_008538|OH1004|CDS

ATGAACCACCAACCCTTACTGGATTCCTCCGCCACTTCCCTCTCCGCCAAATCCTGGCTAGACGACGCCTGCATTGTAGACATCGACTGCTTCGTCAAAACCCTTTCCGGCATCAAAGCCAACGGTGTCCGCCCGGACCTCATTGGGTCTATCATCACACATTACGCTTCCAAATGGATTCCCGAACTCTCCGGCGAATCACCACCCCCTGTCGCCACCGAGCCCCAGTCTCCCTCAGAAAGCGCCACCGCGTCTTGGCT...

Protein

Download Protein FASTA

416 aa · LXL04_008538|LXL04_008538|OH1004|PROTEIN

MNHQPLLDSSATSLSAKSWLDDACIVDIDCFVKTLSGIKANGVRPDLIGSIITHYASKWIPELSGESPPPVATEPQSPSESATASWLKKRFFIETIVAVLPPEKDAVHCSFLLRLLKIANMVGVDASYRQEVEERVAGRLDQATLKEVMIPCFSHVSGTLFDVELMLRLVKRFVELDTEGLRSGAGIFKVAKLVDAYLAEVAVDLEVALPEFMELAEAVPTDARATDDGLYRAIDTYLKTHVNVTKRERKTLCKLIDSQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_008538`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_008538

Location Chr02:102148073-102150399 (-)

Description Similar to CPT1: Coleoptile phototropism protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g03250`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g48800`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g64330`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	Arabidopsis NPH3: A NPH1 photoreceptor-interacting protein essential for phototropism.1999 · DOI: 10.1126/science.286.5441.961 RPT2. A signal transducer of the phototropic response in Arabidopsis.2000 · DOI: 10.1105/tpc.12.2.225 RPT2 is a signal transducer involved in phototropic response and stomatal opening by association with phototropin 1 in Arabidopsis thaliana.2004 · DOI: 10.1105/tpc.019901 PHYTOCHROME KINASE SUBSTRATE 1 is a phototropin 1 binding protein required for phototropism.2006 · DOI: 10.1073/pnas.0603799103 The Arabidopsis PHYTOCHROME KINASE SUBSTRATE2 protein is a phototropin signaling element that regulates leaf flattening and leaf positioning.2010 · DOI: 10.1104/pp.109.150441
`At5g67385`	Acts as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (Probable).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0568200`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	The Rice COLEOPTILE PHOTOTROPISM1 gene encoding an ortholog of Arabidopsis NPH3 is required for phototropism of coleoptiles and lateral translocation of auxin.2005 · DOI: 10.1105/tpc.104.028357

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008538 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009638 phototropism Biological Process

GO:0009785 blue light signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT5G03250

ath:AT5G48800

ath:AT5G64330

dosa:Os02g0568200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.515

Rank 1 · LXL04_008538 · OH-1004

Cytoplasm0.369

Rank 2 · LXL04_008538 · OH-1004

Cell membrane0.202

Rank 3 · LXL04_008538 · OH-1004

Endoplasmic reticulum0.065

Rank 4 · LXL04_008538 · OH-1004

Golgi apparatus0.028

Rank 5 · LXL04_008538 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03000.20NPH318-266 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_008538	`PF03000.20`	NPH3	18	266	1.9e-76	257.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYW0`	Arabidopsis thaliana	BTB/POZ domain-containing protein At5g03250	35.676%	Swiss-Prot	moderate database homology
`Q9FKB6`	Arabidopsis thaliana	BTB/POZ domain-containing protein At5g48800	35.230%	Swiss-Prot	moderate database homology
`Q9FMF5`	Arabidopsis thaliana	Root phototropism protein 3	36.639%	Swiss-Prot	moderate database homology
`Q66GP0`	Arabidopsis thaliana	BTB/POZ domain-containing protein SR1IP1	38.078%	Swiss-Prot	moderate database homology
`Q5KS50`	Oryza sativa subsp. japonica	Coleoptile phototropism protein 1	37.391%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card