LXL04_007614 | RubberDandelionOmics

Gene overview

LXL04_007614

Reference: OH-1004 Chr: Chr02 Coordinates: 54203463-54206193 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

753 bp · LXL04_007614|LXL04_007614|OH1004|cDNA

ATGGGACGACACACCAGGTCCGGCCGGAGCAGAAGTTACAGTCCTCGTCGCAGTCCAACGCCACCTCCACCAACACGACGTCGTTACGATGACCCTCGAGACAGTCGTTACGATGACCCCCGAGACAGTCGTTACGATGACTTCCGAGACCGTCGTTCTAACACACACCGCCGCCGGTCTCCTGCTCCCTCCGGCCTCCTCGTTCGCAATATATCTCTTGGTTCTAGACCAGAAGATTTGAGGATACCTTTTGAACGATT...

CDS

Download CDS FASTA

753 bp · LXL04_007614|LXL04_007614|OH1004|CDS

ATGGGACGACACACCAGGTCCGGCCGGAGCAGAAGTTACAGTCCTCGTCGCAGTCCAACGCCACCTCCACCAACACGACGTCGTTACGATGACCCTCGAGACAGTCGTTACGATGACCCCCGAGACAGTCGTTACGATGACTTCCGAGACCGTCGTTCTAACACACACCGCCGCCGGTCTCCTGCTCCCTCCGGCCTCCTCGTTCGCAATATATCTCTTGGTTCTAGACCAGAAGATTTGAGGATACCTTTTGAACGATT...

Protein

Download Protein FASTA

250 aa · LXL04_007614|LXL04_007614|OH1004|PROTEIN

MGRHTRSGRSRSYSPRRSPTPPPPTRRRYDDPRDSRYDDPRDSRYDDFRDRRSNTHRRRSPAPSGLLVRNISLGSRPEDLRIPFERFGPVKDVYLPKNYYTGEPRGFGFVKFRNPEDAAEAKHQLNHRVIGGREIAIVFAEENRKTPREMRTTSQPSGRYGGGSSRRTPPRFSRRRSYSRSVSPARRDFSHKSQDHVVRPRSRDGGRYKATSPARNGNLRSQEIKDSPHEIRDTEDPGPSSRSPPPHHDR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007614`
TK1151 ID	TkA03G197190
OH-1004 ID	LXL04_007614
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.938 / OH-1004 76.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007614

Location Chr02:54203463-54206193 (-)

Description Similar to SCL28: Serine/arginine-rich SC35-like splicing factor SCL28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18810`	Involved in intron recognition and spliceosome assembly (Probable).	No verified direct reference in this release
`At3g13570`	Involved in intron recognition and spliceosome assembly.	Identification of an intronic splicing regulatory element involved in auto-regulation of alternative splicing of SCL33 pre-mRNA.2012 · DOI: 10.1111/tpj.12004
`At1g55310`	Involved in intron recognition and spliceosome assembly.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007614 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000244 spliceosomal tri-snRNP complex assembly Biological Process

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000395 mRNA 5'-splice site recognition Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006376 mRNA splice site recognition Biological Process

GO:0008380 RNA splicing Biological Process

GO:0016482 cytosolic transport Biological Process

GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process

GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G55310

ath:AT3G13570

ath:AT5G18810

hsa:135295

mmu:14105

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · LXL04_007614 · OH-1004

Cytoplasm0.171

Rank 2 · LXL04_007614 · OH-1004

Cell membrane0.013

Rank 3 · LXL04_007614 · OH-1004

Mitochondrion0.009

Rank 4 · LXL04_007614 · OH-1004

Endoplasmic reticulum0.007

Rank 5 · LXL04_007614 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_166-135 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007614	`PF00076.29`	RRM_1	66	135	3.2e-17	62.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q1PDV2`	Arabidopsis thaliana	Serine/arginine-rich SC35-like splicing factor SCL28	69.492%	Swiss-Prot	weak database homology
`Q9LHP2`	Arabidopsis thaliana	Serine/arginine-rich SC35-like splicing factor SCL30A	64.211%	Swiss-Prot	weak database homology
`Q9SEU4`	Arabidopsis thaliana	Serine/arginine-rich SC35-like splicing factor SCL33	62.500%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card