LXL04_007470 | RubberDandelionOmics

Gene overview

LXL04_007470

Reference: OH-1004 Chr: Chr02 Coordinates: 49318854-49320623 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1164 bp · LXL04_007470|LXL04_007470|OH1004|cDNA

atgtcatttttgACCCCGACGATTCTCATCAGTTTCCCTCCCGACGCCGCCGCGGTTAACTCATCGTCGCAGTTCTCCATGGATCCCGACGGACTTCCTCAGCCGCTCATCAACCTCTCAAAGGTACAATCACGAATGGACCACATCCACCGCTTCCTCTCCGCTTCACTCAACTCCAATTCCATCATTGGAGAATCGCAGATGGATATTGTCTCTAAGGAGATCGCATCCGCAATCAACCAAGTAATTGTCAACGGAGC...

CDS

Download CDS FASTA

1164 bp · LXL04_007470|LXL04_007470|OH1004|CDS

ATGTCATTTTTGACCCCGACGATTCTCATCAGTTTCCCTCCCGACGCCGCCGCGGTTAACTCATCGTCGCAGTTCTCCATGGATCCCGACGGACTTCCTCAGCCGCTCATCAACCTCTCAAAGGTACAATCACGAATGGACCACATCCACCGCTTCCTCTCCGCTTCACTCAACTCCAATTCCATCATTGGAGAATCGCAGATGGATATTGTCTCTAAGGAGATCGCATCCGCAATCAACCAAGTAATTGTCAACGGAGC...

Protein

Download Protein FASTA

387 aa · LXL04_007470|LXL04_007470|OH1004|PROTEIN

MSFLTPTILISFPPDAAAVNSSSQFSMDPDGLPQPLINLSKVQSRMDHIHRFLSASLNSNSIIGESQMDIVSKEIASAINQVIVNGAALLSCTGLPKSKSETPNLSLPPTTLTFDSKHSPESDLGLNHSKHDVELGFAKIEVFGEEAGDDWDIVELDAVELLAEHLHFCDLCGKGFKRDANLRMHMRAHGNKFKTLEALAKPEKSGLSSSSESTRGGRTRFSCPFAGCTRNKLHKKFRPLKSVICVKNHFKRSHCPKMYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_007470`
TK1151 ID	TkA03G180010
OH-1004 ID	LXL04_007470
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 93.282 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_007470

Location Chr02:49318854-49320623 (-)

Description Similar to STOP1: Protein SENSITIVE TO PROTON RHIZOTOXICITY 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34370`	Probable transcription factor.	Zinc finger protein STOP1 is critical for proton tolerance in Arabidopsis and coregulates a key gene in aluminum tolerance.2007 · DOI: 10.1073/pnas.0700117104 Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance.2009 · DOI: 10.1111/j.1365-313x.2008.03696.x STOP1 regulates multiple genes that protect arabidopsis from proton and aluminum toxicities.2009 · DOI: 10.1104/pp.108.134700 STOP2 activates transcription of several genes for Al- and low pH-tolerance that are regulated by STOP1 in Arabidopsis.2014 · DOI: 10.1093/mp/sst116
`At5g22890`	Probable transcription factor.	STOP2 activates transcription of several genes for Al- and low pH-tolerance that are regulated by STOP1 in Arabidopsis.2014 · DOI: 10.1093/mp/sst116
`At5g66730`	Transcription factor promoting the transition to germination by regulating light and hormonal signaling during seed maturation.	The Arabidopsis C2H2 zinc finger INDETERMINATE DOMAIN1/ENHYDROUS promotes the transition to germination by regulating light and hormonal signaling during seed maturation.2011 · DOI: 10.1105/tpc.111.085134 DELLAs function as coactivators of GAI-ASSOCIATED FACTOR1 in regulation of gibberellin homeostasis and signaling in Arabidopsis.2014 · DOI: 10.1105/tpc.114.125690

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0871200`	Probable transcription factor that may be involved in aluminum tolerance.	No verified direct reference in this release
`Os12g0170400`	Transcriptional activator that regulates the expression of genes involved in aluminum (Al) tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_007470 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009937 regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010044 response to aluminum ion Biological Process

GO:0010431 seed maturation Biological Process

GO:0010447 response to acidic pH Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0071453 cellular response to oxygen levels Biological Process

GO:0071472 cellular response to salt stress Biological Process

KEGG gene cross-reference

ath:AT1G34370

ath:AT5G22890

ath:AT5G66730

dosa:Os01g0871200

dosa:Os12g0170400

osa:4324940

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · LXL04_007470 · OH-1004

Cytoplasm0.076

Rank 2 · LXL04_007470 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_007470 · OH-1004

Endoplasmic reticulum0.015

Rank 4 · LXL04_007470 · OH-1004

Plastid0.009

Rank 5 · LXL04_007470 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00096.33zf-C2H2167-189 aa

PF23115.2zf-C2H2_STOP2_3rd221-255 aa

PF23118.3zf-C2H2_STOP2_C286-314 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_007470	`PF00096.33`	zf-C2H2	167	189	1.9e-06	28.7
LXL04_007470	`PF23115.2`	zf-C2H2_STOP2_3rd	221	255	1.1e-19	70.8
LXL04_007470	`PF23118.3`	zf-C2H2_STOP2_C	286	314	3.6e-20	71.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8N5`	Arabidopsis thaliana	Protein SENSITIVE TO PROTON RHIZOTOXICITY 1	63.095%	Swiss-Prot	weak database homology
`Q0WT24`	Arabidopsis thaliana	Protein SENSITIVE TO PROTON RHIZOTOXICITY 2	60.714%	Swiss-Prot	weak database homology
`Q9LVQ7`	Arabidopsis thaliana	Zinc finger protein ENHYDROUS	30.964%	Swiss-Prot	weak database homology
`Q943I6`	Oryza sativa subsp. japonica	Zinc finger protein STOP1 homolog	65.060%	Swiss-Prot	weak database homology
`Q2QX40`	Oryza sativa subsp. japonica	Zinc finger protein STAR3	58.896%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card