LXL04_006956 | RubberDandelionOmics

Gene overview

LXL04_006956

Reference: OH-1004 Chr: Chr02 Coordinates: 32012765-32020919 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2775 bp · LXL04_006956|LXL04_006956|OH1004|cDNA

ATGATGGAAGGATTGAATTATCAGAATTCAAGATTGGTTTTCTGTTGTGTTATAATCTGTTTCTTCATAGCCATCCAATCAACCTGTTCACAAAAAGATTTTCTAAGTATCCAGTGTTGTGCCGATTCAAACTCCACTGAtccaaaaaccaacataacaTGGATTACAGATAACAAATGGTTCAAAAACAACCAACAATGCCAAGACATAATAACACCATTACAAAACAGTACAACTTACGATCATGCTCGGTTTTTTGA...

CDS

Download CDS FASTA

2775 bp · LXL04_006956|LXL04_006956|OH1004|CDS

ATGATGGAAGGATTGAATTATCAGAATTCAAGATTGGTTTTCTGTTGTGTTATAATCTGTTTCTTCATAGCCATCCAATCAACCTGTTCACAAAAAGATTTTCTAAGTATCCAGTGTTGTGCCGATTCAAACTCCACTGATCCAAAAACCAACATAACATGGATTACAGATAACAAATGGTTCAAAAACAACCAACAATGCCAAGACATAATAACACCATTACAAAACAGTACAACTTACGATCATGCTCGGTTTTTTGA...

Protein

Download Protein FASTA

924 aa · LXL04_006956|LXL04_006956|OH1004|PROTEIN

MMEGLNYQNSRLVFCCVIICFFIAIQSTCSQKDFLSIQCCADSNSTDPKTNITWITDNKWFKNNQQCQDIITPLQNSTTYDHARFFDINHGTKWCYNLPTKRGHDYLVRGTFVTSPIDTFFDVLIGTTPIGRVGPLDEDEVEGIVKANDDYIDFCLLKKQGNPYVSKIELRPLDLDYGESLNLLKVVHRVDVGNIRGEIRYPQDRYDQIWKPDSDLNQNKNSTLLNVDTNIQNGTKSSPPTEVLQTARTHLERLEFIHNL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006956`
TK1151 ID	TkA03G101350
OH-1004 ID	LXL04_006956
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006956

Location Chr02:32012765-32020919 (+)

Description Similar to NORK: Nodulation receptor kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67720`	Probable LRR receptor-like serine/threonine-protein kinase At1g67720.	No verified direct reference in this release
`At5g48740`	Probable LRR receptor-like serine/threonine-protein kinase At5g48740.	No verified direct reference in this release
`At3g21340`	Probable receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006956 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009877 nodulation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004714 transmembrane receptor protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G67720

ath:AT3G21340

ath:AT5G48740

mtr:11407326

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.849

Rank 1 · LXL04_006956 · OH-1004

Cytoplasm0.087

Rank 2 · LXL04_006956 · OH-1004

Endoplasmic reticulum0.084

Rank 3 · LXL04_006956 · OH-1004

Nucleus0.049

Rank 4 · LXL04_006956 · OH-1004

Lysosome / Vacuole0.032

Rank 5 · LXL04_006956 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12819.14Malectin_like39-346 aa

PF11721.15Malectin199-305 aa

PF08263.18LRRNT_2355-397 aa

PF07714.24PK_Tyr_Ser-Thr597-866 aa

PF00069.32Pkinase597-801 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006956	`PF12819.14`	Malectin_like	39	346	8.6e-50	170.6
LXL04_006956	`PF11721.15`	Malectin	199	305	6.4e-09	36.7
LXL04_006956	`PF08263.18`	LRRNT_2	355	397	1.2e-06	29.4
LXL04_006956	`PF07714.24`	PK_Tyr_Ser-Thr	597	866	1.9e-43	149.4
LXL04_006956	`PF00069.32`	Pkinase	597	801	3.1e-40	139.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGI2`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g67720	35.072%	Swiss-Prot	moderate database homology
`C0LGV0`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At5g48740	32.465%	Swiss-Prot	moderate database homology
`Q9LIG2`	Arabidopsis thaliana	Receptor-like protein kinase At3g21340	31.210%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card