LXL04_006919 | RubberDandelionOmics

Gene overview

LXL04_006919

Reference: OH-1004 Chr: Chr02 Coordinates: 29850202-29852195 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1185 bp · LXL04_006919|LXL04_006919|OH1004|cDNA

ATGGTGAATCCGCGGTGTTATTTGGATATAAGCATTGGAGGTGAGCTTGAAGGGAGATTAGTGGTGGAGCTTTACAAAGACATTGTTCCCAAAACTGCTGAGAATTTTAGGGCTCTTTGTACTGGAGAAAAGGGTATTGGTCCTAACACTGGCGTTCCTCTTCATTTGAAGGGCTCATGTTTCCACCGTGTAATCAAAGGCTTCATGATCCAAGGTGGAGACATATCAGCAAGAAACGGAACGGGAGGCGAATCAATCTA...

CDS

Download CDS FASTA

1185 bp · LXL04_006919|LXL04_006919|OH1004|CDS

ATGGTGAATCCGCGGTGTTATTTGGATATAAGCATTGGAGGTGAGCTTGAAGGGAGATTAGTGGTGGAGCTTTACAAAGACATTGTTCCCAAAACTGCTGAGAATTTTAGGGCTCTTTGTACTGGAGAAAAGGGTATTGGTCCTAACACTGGCGTTCCTCTTCATTTGAAGGGCTCATGTTTCCACCGTGTAATCAAAGGCTTCATGATCCAAGGTGGAGACATATCAGCAAGAAACGGAACGGGAGGCGAATCAATCTA...

Protein

Download Protein FASTA

394 aa · LXL04_006919|LXL04_006919|OH1004|PROTEIN

MVNPRCYLDISIGGELEGRLVVELYKDIVPKTAENFRALCTGEKGIGPNTGVPLHLKGSCFHRVIKGFMIQGGDISARNGTGGESIYGSKFEDENFELKHERKGMLSMANSGPNTNGSQFFITTTRTSHLDGKHVVFGRVVKGMGVVRSVEHTTTGEHDLPTQDVVIEDCGELLEGADDGVCDFFKDGDTYPDWPLDLDVKPEEVSWWMTAVDAIKAFGNEQFKKQDYKNALRKYRKALRYLDVCWEKEDIDEGKTDSLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006919`
TK1151 ID	TkA03G088850
OH-1004 ID	LXL04_006919
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006919

Location Chr02:29850202-29852195 (-)

Description Similar to CYP40: Peptidyl-prolyl cis-trans isomerase CYP40

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g15790`	PPIases accelerate the folding of proteins.	Regulation of vegetative phase change in Arabidopsis thaliana by cyclophilin 40.2001 · DOI: 10.1126/science.1057144

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006919 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0000413 protein peptidyl-prolyl isomerization Biological Process

GO:0006457 protein folding Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0010050 vegetative phase change Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0015031 protein transport Biological Process

GO:0019076 viral release from host cell Biological Process

GO:0034389 lipid droplet organization Biological Process

GO:0045070 positive regulation of viral genome replication Biological Process

GO:0050714 positive regulation of protein secretion Biological Process

GO:0051881 regulation of mitochondrial membrane potential Biological Process

KEGG gene cross-reference

ath:AT2G15790

bta:281420

hsa:5481

mmu:67738

rno:361967

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.526

Rank 1 · LXL04_006919 · OH-1004

Nucleus0.304

Rank 2 · LXL04_006919 · OH-1004

Mitochondrion0.161

Rank 3 · LXL04_006919 · OH-1004

Endoplasmic reticulum0.076

Rank 4 · LXL04_006919 · OH-1004

Cell membrane0.071

Rank 5 · LXL04_006919 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00160.27Pro_isomerase7-171 aa

PF00515.35TPR_1298-331 aa

PF07719.24TPR_2299-331 aa

PF13181.13TPR_8299-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006919	`PF00160.27`	Pro_isomerase	7	171	8.9e-50	169.7
LXL04_006919	`PF00515.35`	TPR_1	298	331	6.7e-09	35.9
LXL04_006919	`PF07719.24`	TPR_2	299	331	1.1e-10	41.4
LXL04_006919	`PF13181.13`	TPR_8	299	331	2.1e-06	28.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C566`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP40	76.163%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card