LXL04_006624 | RubberDandelionOmics

Gene overview

LXL04_006624

Reference: OH-1004 Chr: Chr02 Coordinates: 20172422-20176493 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2589 bp · LXL04_006624|LXL04_006624|OH1004|cDNA

ATGGCTAGTCCTCAGTCGGGACGATTTGCAGTTACTCCAACAACACCCAACAATTCGTCTAGGGTTTTGAGCTTGAAAAGTCCGTTAAGTGATGAAACCATATGGAAGCGTCTTCGTGAAGCAGGCTTCGATGAAGAATCGATTAGGCGAAGGGATAAAGGATCGCTCATAGCTCACATCGCTAAACTCGAAGCTGAGATATACAACCTTCAAAATCAAATGGGGATTTTAATCATTGAAAAAAAAGAGTGGGTTGCCAA...

CDS

Download CDS FASTA

2589 bp · LXL04_006624|LXL04_006624|OH1004|CDS

ATGGCTAGTCCTCAGTCGGGACGATTTGCAGTTACTCCAACAACACCCAACAATTCGTCTAGGGTTTTGAGCTTGAAAAGTCCGTTAAGTGATGAAACCATATGGAAGCGTCTTCGTGAAGCAGGCTTCGATGAAGAATCGATTAGGCGAAGGGATAAAGGATCGCTCATAGCTCACATCGCTAAACTCGAAGCTGAGATATACAACCTTCAAAATCAAATGGGGATTTTAATCATTGAAAAAAAAGAGTGGGTTGCCAA...

Protein

Download Protein FASTA

862 aa · LXL04_006624|LXL04_006624|OH1004|PROTEIN

MASPQSGRFAVTPTTPNNSSRVLSLKSPLSDETIWKRLREAGFDEESIRRRDKGSLIAHIAKLEAEIYNLQNQMGILIIEKKEWVANYEQMKSTAESAEMTLKSNQAAHLSALAEAKKREEKLKKSLGIEKECVSNIEKALHEMRAECAEAKVAAEIKLAEARTLMEDALKKMTEANSKMQTAESLESEATRYRKSAERKLHEVEAREDDLRRQINSFKLECEAKEKEVVLEKQSLCERQKSVQQSQERLLDGQALLNQR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006624`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006624

Location Chr02:20172422-20176493 (+)

Description Similar to CRWN4: Protein CROWDED NUCLEI 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65770`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031 Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization.2013 · DOI: 10.1186/1471-2229-13-200
`At1g67230`	Component of SUN-protein-containing multivariate complexes also called LINC complexes which link the nucleoskeleton and cytoskeleton by providing versatile outer nuclear membrane attachment sites for cytoskeletal filaments (By similarity).	LITTLE NUCLEI genes affecting nuclear morphology in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.107.053231 LITTLE NUCLEI 1 and 4 regulate nuclear morphology in Arabidopsis thaliana.2013 · DOI: 10.1093/pcp/pct031 Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization.2013 · DOI: 10.1186/1471-2229-13-200 The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis.2014 · DOI: 10.1105/tpc.113.122168

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0767000`	Architectural component of nuclear structure that plays different roles in controlling nuclear size and morphology (Probable).	A lamin-like protein OsNMCP1 regulates drought resistance and root growth through chromatin accessibility modulation by interacting with a chromatin remodeller OsSWI3C in rice.2020 · DOI: 10.1111/nph.16518

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006624 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006974 DNA damage response Biological Process

GO:0006997 nucleus organization Biological Process

GO:0043578 nuclear matrix organization Biological Process

GO:0097298 regulation of nucleus size Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:2000280 regulation of root development Biological Process

GO:0000785 chromatin Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005652 nuclear lamina Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G67230

ath:AT5G65770

dosa:Os01g0767000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.591

Rank 1 · LXL04_006624 · OH-1004

Nucleus0.372

Rank 2 · LXL04_006624 · OH-1004

Cell membrane0.078

Rank 3 · LXL04_006624 · OH-1004

Golgi apparatus0.032

Rank 4 · LXL04_006624 · OH-1004

Endoplasmic reticulum0.029

Rank 5 · LXL04_006624 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27881.2CRWN_N51-347 aa

PF30919.1CRWN_second_CC483-725 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006624	`PF27881.2`	CRWN_N	51	347	1.7e-103	346.6
LXL04_006624	`PF30919.1`	CRWN_second_CC	483	725	5e-42	144.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLH0`	Arabidopsis thaliana	Protein CROWDED NUCLEI 4	49.639%	Swiss-Prot	moderate database homology
`F4HRT5`	Arabidopsis thaliana	Protein CROWDED NUCLEI 1	29.044%	Swiss-Prot	weak database homology
`Q0JJ05`	Oryza sativa subsp. japonica	Nuclear matrix constituent protein 1b	40.205%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card