LXL04_004690 | RubberDandelionOmics

Gene overview

LXL04_004690

Reference: OH-1004 Chr: Chr01 Coordinates: 143606267-143611669 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1611 bp · LXL04_004690|LXL04_004690|OH1004|cDNA

atggaatccaatgATTTCAAAATCTTGATACAAAAATGGCGTGAAAGAAAGCTTTGCATGGCGAGTCACCGAGTTGGAGAGACCGGTTTGTCAGACTCAGGACCTTCACACCATCACCATCACCACCAACACCTGCCATACTCTGTTTTTCCTGCCTTTAATCCTCCTAACACCGCCTTCATTAACCAAGAAGGGTCGTCGTTCGATTTTGGGGAGCTAGAAGAAGCTATAGTGCTTCAAGGTTACAACAAGATCCATGG...

CDS

Download CDS FASTA

1611 bp · LXL04_004690|LXL04_004690|OH1004|CDS

ATGGAATCCAATGATTTCAAAATCTTGATACAAAAATGGCGTGAAAGAAAGCTTTGCATGGCGAGTCACCGAGTTGGAGAGACCGGTTTGTCAGACTCAGGACCTTCACACCATCACCATCACCACCAACACCTGCCATACTCTGTTTTTCCTGCCTTTAATCCTCCTAACACCGCCTTCATTAACCAAGAAGGGTCGTCGTTCGATTTTGGGGAGCTAGAAGAAGCTATAGTGCTTCAAGGTTACAACAAGATCCATGG...

Protein

Download Protein FASTA

536 aa · LXL04_004690|LXL04_004690|OH1004|PROTEIN

MESNDFKILIQKWRERKLCMASHRVGETGLSDSGPSHHHHHHQHLPYSVFPAFNPPNTAFINQEGSSFDFGELEEAIVLQGYNKIHGDETKLPLYATVPRPAATLDMFPSWPMRVHQTPRGSNSSTDSGSGVNVAIPGKPETHSHIEPESPISSNSKKASSNQNQQQEQQHQQAIFRQQLQNLQIPEQNLEMESEGGSPVTTGGSSHSQQALKPFSEKKKGIGSTSERSLDAKTLRRLAQNREAARKSRLRKKAYVQQLE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004690`
TK1151 ID	TkA01G122070
OH-1004 ID	LXL04_004690
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.100
Protein coverage (%)	TK1151 100.000 / OH-1004 96.455 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_004690

Location Chr01:143606267-143611669 (-)

Description Similar to TGA9: Transcription factor TGA9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08320`	Together with TGA10, basic leucine-zipper transcription factor required for anther development, probably via the activation of SPL expression in anthers and via the regulation of genes with functions in early and middle tapetal development.	Arabidopsis basic leucine-zipper transcription factors TGA9 and TGA10 interact with floral glutaredoxins ROXY1 and ROXY2 and are redundantly required for anther development.2010 · DOI: 10.1104/pp.110.159111 Arabidopsis clade IV TGA transcription factors, TGA10 and TGA9, are involved in ROS-mediated responses to bacterial PAMP flg22.2016 · DOI: 10.1016/j.plantsci.2016.06.019

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0152700`	Transcriptional regulator involved in defense response.	No verified direct reference in this release
`Os01g0859500`	Transcriptional regulator involved in defense response (By similarity).	No verified direct reference in this release
`Os05g0443900`	Transcriptional regulator involved in defense response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004690 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048653 anther development Biological Process

GO:0071588 hydrogen peroxide mediated signaling pathway Biological Process

GO:1905623 positive regulation of leaf development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G08320

dosa:Os01g0859500

dosa:Os05g0443900

dosa:Os11g0152700

osa:4338933

osa:4349800

zma:541670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.895

Rank 1 · LXL04_004690 · OH-1004

Cytoplasm0.173

Rank 2 · LXL04_004690 · OH-1004

Cell membrane0.038

Rank 3 · LXL04_004690 · OH-1004

Endoplasmic reticulum0.023

Rank 4 · LXL04_004690 · OH-1004

Mitochondrion0.015

Rank 5 · LXL04_004690 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07716.21bZIP_2230-274 aa

PF00170.27bZIP_1232-273 aa

PF14144.12DOG1313-387 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004690	`PF07716.21`	bZIP_2	230	274	4.3e-06	27.4
LXL04_004690	`PF00170.27`	bZIP_1	232	273	6.5e-08	33.3
LXL04_004690	`PF14144.12`	DOG1	313	387	6.4e-33	113.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93XM6`	Arabidopsis thaliana	Transcription factor TGA9	60.536%	Swiss-Prot	strong database homology
`Q53Q70`	Oryza sativa subsp. japonica	Transcription factor TGAL4	53.196%	Swiss-Prot	strong database homology
`Q5N7C7`	Oryza sativa subsp. japonica	Transcription factor LG2	51.896%	Swiss-Prot	strong database homology
`Q6F2N0`	Oryza sativa subsp. japonica	Transcription factor TGAL5	54.608%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card