Gene Card
Gene overview
cDNA / CDS / Protein Sequences
705 bp · LXL04_004129|LXL04_004129|OH1004|cDNA
ATGGATCCATCTCGTTTTCAATCCCATAAACCACAACCTCCCTCCACTTCAATAACACCAACTGAATCCATTGAAATATCCATCCAAAATCTCATCAAATCCTACAAAACAAGGCAAAAATGGGAGTTTTTCTCAGGATCAACCAAACAAACTTCCAACAACAAACCCCCATGGAGAAACCACTTAACAGCTTTCCTAGAATCAACCCCGGTTCACATCATCGCCATGATATTACTCCTCGCGGATCTTGTTATGGTAGT...
705 bp · LXL04_004129|LXL04_004129|OH1004|CDS
ATGGATCCATCTCGTTTTCAATCCCATAAACCACAACCTCCCTCCACTTCAATAACACCAACTGAATCCATTGAAATATCCATCCAAAATCTCATCAAATCCTACAAAACAAGGCAAAAATGGGAGTTTTTCTCAGGATCAACCAAACAAACTTCCAACAACAAACCCCCATGGAGAAACCACTTAACAGCTTTCCTAGAATCAACCCCGGTTCACATCATCGCCATGATATTACTCCTCGCGGATCTTGTTATGGTAGT...
Protein
Download Protein FASTA234 aa · LXL04_004129|LXL04_004129|OH1004|PROTEIN
MDPSRFQSHKPQPPSTSITPTESIEISIQNLIKSYKTRQKWEFFSGSTKQTSNNKPPWRNHLTAFLESTPVHIIAMILLLADLVMVVLELSKTLVSCPKSRRINKKVDMWYHWVGIGILVILAMKSVALVVGCGRSFFKRPGLVADGVVLIGALVCEVLVEKVGVGLIVVVSLWRVLRVVESVFELSDAAIEVQITSILCQFELLKQENEKLRGIVAEKEKIIDELREELDKRV
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_004129 |
|---|---|
| TK1151 ID | TkA01G199030 |
| OH-1004 ID | LXL04_004129 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 98.100 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 67.094Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_004129 |
|---|---|
| Location | Chr01:126067674-126068378 (+) |
| Description | Similar to HVCN1: Voltage-gated hydrogen channel 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0009268 response to pH Biological Process GO:0010043 response to zinc ion Biological Process GO:0051453 regulation of intracellular pH Biological Process GO:0071294 cellular response to zinc ion Biological Process GO:0071467 cellular response to pH Biological Process GO:1902600 proton transmembrane transport Biological Process GO:1903426 regulation of reactive oxygen species biosynthetic process Biological Process GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0030670 phagocytic vesicle membrane Cellular Component GO:0034702 monoatomic ion channel complex Cellular Component GO:0030171 voltage-gated proton channel activity Molecular Function |
| KEGG gene cross-reference | gga:416871 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.