LXL04_003005 | RubberDandelionOmics

Gene overview

LXL04_003005

Reference: OH-1004 Chr: Chr01 Coordinates: 64639367-64641511 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1098 bp · LXL04_003005|LXL04_003005|OH1004|cDNA

ATGCCTCCACAACAACCGTGCCGGAACTTCCAGCGTGGATACTGTAAATATGGTGAACACTGCAAGTTTCTTCATGGAAATCAACAGCAAGCAAAACCGAATCCTTTTGGTTTTGGCTCACAAAACGCTACACAATCTCCGCGTACTGATCCCCAACCTCAAAAACCCAACCCGTTTGGGTTCGGTGTTCAGAACAACTCGCAGACTGGATCTAAACCTAATCAATTCAAGCCCGGTGAAAATAAATGGAGCCGATTTTC...

CDS

Download CDS FASTA

1098 bp · LXL04_003005|LXL04_003005|OH1004|CDS

ATGCCTCCACAACAACCGTGCCGGAACTTCCAGCGTGGATACTGTAAATATGGTGAACACTGCAAGTTTCTTCATGGAAATCAACAGCAAGCAAAACCGAATCCTTTTGGTTTTGGCTCACAAAACGCTACACAATCTCCGCGTACTGATCCCCAACCTCAAAAACCCAACCCGTTTGGGTTCGGTGTTCAGAACAACTCGCAGACTGGATCTAAACCTAATCAATTCAAGCCCGGTGAAAATAAATGGAGCCGATTTTC...

Protein

Download Protein FASTA

365 aa · LXL04_003005|LXL04_003005|OH1004|PROTEIN

MPPQQPCRNFQRGYCKYGEHCKFLHGNQQQAKPNPFGFGSQNATQSPRTDPQPQKPNPFGFGVQNNSQTGSKPNQFKPGENKWSRFSPINNANPPAPQKQDTQANHVCTDSESCKRQINEDYQHEKPLWKLTCYGHCKYGPCDIIGDISIEELRAAAYDDAKRGMPIQTIVEKERSLVNSKLIEFENLLRNPYKTPQQNSTLATQNTFSGNTPQMVQNNPTPPTVSSFSQLGTTVNSGFQMRPAAPNSTFGQVNQFQPPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_003005`
TK1151 ID	TkA01G073490
OH-1004 ID	LXL04_003005
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.000
Protein coverage (%)	TK1151 93.689 / OH-1004 52.877 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_003005

Location Chr01:64639367-64641511 (-)

Description Similar to CG1: Zinc finger CCCH domain-containing protein 16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75340`	Zinc finger CCCH domain-containing protein 16.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0704300`	Transcriptional activator that binds double-stranded DNA and the single-stranded RNA polymers poly(rA), poly(rU) and poly(rG), but not poly(rC).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003005 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0015031 protein transport Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0051028 mRNA transport Biological Process

GO:1900458 negative regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G75340

dosa:Os06g0704300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.885

Rank 1 · LXL04_003005 · OH-1004

Cytoplasm0.255

Rank 2 · LXL04_003005 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_003005 · OH-1004

Mitochondrion0.019

Rank 4 · LXL04_003005 · OH-1004

Endoplasmic reticulum0.017

Rank 5 · LXL04_003005 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00642.31zf-CCCH5-26 aa

PF18345.8zf_CCCH_47-25 aa

PF27634.2Amo1_N113-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_003005	`PF00642.31`	zf-CCCH	5	26	6.5e-08	33.0
LXL04_003005	`PF18345.8`	zf_CCCH_4	7	25	5.2e-06	27.1
LXL04_003005	`PF27634.2`	Amo1_N	113	165	3.2e-07	31.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FWS3`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 16	40.632%	Swiss-Prot	moderate database homology
`Q5Z807`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 46	39.329%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card