LXL04_002713 | RubberDandelionOmics

Gene overview

LXL04_002713

Reference: OH-1004 Chr: Chr01 Coordinates: 55721569-55732896 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4959 bp · LXL04_002713|LXL04_002713|OH1004|cDNA

ATGCCACTTGTTGGAGCATCTTTATTTTTGAATCCATCTCGCTGTTCAAAAAAAATCTAATCAACATCTCCACTCCCTCTCCTGGCGGCAATGCTCGAAACAGAGGTTCAGGATATATCTAATGACGTCGATTACGCCGCCGCATCTCAAGAAGGCTCGTTAAGTAGCAAGCAAAGCTCTTGTAGCCAGCTAGAAAATGCAGAAATAGTGTATTTGAAGGATAATGTCACAATTAACCCAACTCAATATGCAGCCGGCAG...

CDS

Download CDS FASTA

4878 bp · LXL04_002713|LXL04_002713|OH1004|CDS

CTGGCGGCAATGCTCGAAACAGAGGTTCAGGATATATCTAATGACGTCGATTACGCCGCCGCATCTCAAGAAGGCTCGTTAAGTAGCAAGCAAAGCTCTTGTAGCCAGCTAGAAAATGCAGAAATAGTGTATTTGAAGGATAATGTCACAATTAACCCAACTCAATATGCAGCCGGCAGGATCAGTGGACAGTTAAAGCTTATTAAGCAAGATTCCTTGCTATTTATGGCACAAGGCGTCTGGGACGCTGTTGAGCCTAA...

Protein

Download Protein FASTA

1625 aa · LXL04_002713|LXL04_002713|OH1004|PROTEIN

MAAMLETEVQDISNDVDYAAASQEGSLSSKQSSCSQLENAEIVYLKDNVTINPTQYAAGRISGQLKLIKQDSLLFMAQGVWDAVEPKNLREVVDVRRDKMAMAAIYQGLPEELLLSLAEKETAKEAWKTLKVMYMGAERVRTAKVQTLKAEFEALKMNETDSVDDFSMKLNNLVNNIRALGDKIDEAYVVKKLLQFVQLKTHEERSRGPRESDEKKLLLTQDEWKARFKKTGTGESSSNQKHQLFDVGQGRGRGRGRGCS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_002713`
TK1151 ID	TkA01G425990
OH-1004 ID	LXL04_002713
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 81.781 / OH-1004 24.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_002713`
Location	Chr01:55721569-55732896 (-)
Description	Similar to Tbc1d15: TBC1 domain family member 15
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_002713` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006914 autophagy Biological Process GO:0015031 protein transport Biological Process GO:0042147 retrograde transport, endosome to Golgi Biological Process GO:0043087 regulation of GTPase activity Biological Process GO:0005576 extracellular region Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005776 autophagosome Cellular Component GO:0005829 cytosol Cellular Component GO:0055037 recycling endosome Cellular Component GO:0005096 GTPase activator activity Molecular Function
KEGG gene cross-reference	hsa:64786 hsa:79735 mmu:233204 mmu:66687 yli:2907695 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.620

Rank 1 · LXL04_002713 · OH-1004

Nucleus0.390

Rank 2 · LXL04_002713 · OH-1004

Mitochondrion0.065

Rank 3 · LXL04_002713 · OH-1004

Cell membrane0.063

Rank 4 · LXL04_002713 · OH-1004

Endoplasmic reticulum0.058

Rank 5 · LXL04_002713 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223.15Retrotran_gag_274-195 aa

PF22936.2Pol_BBD362-404 aa

PF13976.12gag_pre-integrs437-480 aa

PF00665.33rve495-592 aa

PF25597.2SH3_retrovirus634-697 aa

PF07727.20RVT_2845-1015 aa

PF12068.15PH_RBD1229-1307 aa

PF00566.26RabGAP-TBC1353-1581 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_002713	`PF14223.15`	Retrotran_gag_2	74	195	6.4e-17	62.5
LXL04_002713	`PF22936.2`	Pol_BBD	362	404	1.7e-10	41.8
LXL04_002713	`PF13976.12`	gag_pre-integrs	437	480	1.2e-06	28.9
LXL04_002713	`PF00665.33`	rve	495	592	5.6e-12	46.5
LXL04_002713	`PF25597.2`	SH3_retrovirus	634	697	9.2e-20	70.9
LXL04_002713	`PF07727.20`	RVT_2	845	1015	1.9e-58	198.6
LXL04_002713	`PF12068.15`	PH_RBD	1229	1307	6.3e-10	39.4
LXL04_002713	`PF00566.26`	RabGAP-TBC	1353	1581	2.7e-50	171.7
LXL04_002713	`PF23436.2`	RabGap-TBC_2	1439	1596	2.1e-14	54.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card