TkA06G466200 | RubberDandelionOmics

Gene overview

TkA06G466200

Reference: TK1151 Chr: Chr06 Coordinates: 115344475-115347261 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2265 bp · TkA06G466200|TK1151|cDNA

TTTGAATACCAACGTGAAATTTTGTCTTTTAGTTATAATAAAACCTTATTCTAAATTTAGCAAAGTCTTGGTCTGGAAAAAAGATTCCCAAAATCTTCAACCTCGAGTTCCCCATCTCATCACAAGAACCATCTACTCACTCTTCAGCACCTCCGCGTATTCATGGCCGCCCATGGCCACCGTTAACAGCCGACTTGGTCACCGTTTTTCCCAATTCCACCACTTTCCCCCAATCCGATCGATCCACCATGTCGACGGCA...

CDS

Download CDS FASTA

1155 bp · TkA06G466200|TK1151|CDS

ATGTCGACGGCAGCACCCTCTTCTTCATCCGAATCCAACACCCCCAACATCGACGCCACTCCATTACTCTCCACAACCTCCGCCATTTCCGACCAAATCTTCCTCACCCGGCGATTCGTCCGAGGCCCACCTTCCCTTCGCGGCGCCGCGAGGTTCCTCCGTCGCGCCAGCAGCCGGAGAATGCTCCGTGAGCCGTCAATGCGAGTTAGGGAATCCGCCACCGAGCAAATCGAGGAGCGGCAGAGCGACTGGGCGTATTC...

Protein

Download Protein FASTA

384 aa · TkA06G466200|TK1151|PROTEIN

MSTAAPSSSSESNTPNIDATPLLSTTSAISDQIFLTRRFVRGPPSLRGAARFLRRASSRRMLREPSMRVRESATEQIEERQSDWAYSRPIVILDLIWNLAFITVSVAVLVMSLNESPVMPLRIWIVGYAFQCLLHMVCVYVEYRHRYHQRSITSMEASSLNSNFSSSGNEGLESGDLASSRLQNEDDASVAKHLESANTMFSFIWWIIGFYWVSGGGPNLSSESPQLYWLCIAFLAFDVFFVVICVAVACVVGIAVCCCL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G466200`
TK1151 ID	TkA06G466200
OH-1004 ID	LXL04_026748
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	72.300
Protein coverage (%)	TK1151 95.573 / OH-1004 93.052 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G466200

Location Chr06:115344475-115347261 (+)

Description Similar to At4g11680: E3 ubiquitin-protein ligase At4g11680

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12760`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At4g11680`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At1g63170`	Mediates E2-dependent protein ubiquitination.	No verified direct reference in this release
`At2g01735`	Probable E3 ubiquitin-protein ligase required for embryo development.	A RING-H2 zinc-finger protein gene RIE1 is essential for seed development in Arabidopsis.2003 · DOI: 10.1023/b:plan.0000009256.01620.a6
`At2g35000`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026748 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030178 negative regulation of Wnt signaling pathway Biological Process

GO:0038018 Wnt receptor catabolic process Biological Process

GO:0060828 regulation of canonical Wnt signaling pathway Biological Process

GO:0072089 stem cell proliferation Biological Process

GO:0090090 negative regulation of canonical Wnt signaling pathway Biological Process

GO:2000051 negative regulation of non-canonical Wnt signaling pathway Biological Process

GO:2000095 regulation of Wnt signaling pathway, planar cell polarity pathway Biological Process

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT1G12760

ath:AT1G63170

ath:AT2G01735

ath:AT4G11680

mmu:407821

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.386

Rank 1 · TkA06G466200 · TK1151

Cytoplasm0.218

Rank 2 · TkA06G466200 · TK1151

Endoplasmic reticulum0.217

Rank 3 · TkA06G466200 · TK1151

Cell membrane0.194

Rank 4 · TkA06G466200 · TK1151

Golgi apparatus0.191

Rank 5 · TkA06G466200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12678zf-rbx1141-153 aa

PF17123zf-RING_11145-149 aa

PF13639zf-RING_2257-262 aa

PF17123zf-RING_11258-262 aa

PF13923zf-C3HC4_2259-266 aa

PF13639zf-RING_2329-371 aa

PF17123zf-RING_11329-357 aa

PF13923zf-C3HC4_2329-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G466200	`PF12678`	zf-rbx1	141	153	4.8e-05	24.2
TkA06G466200	`PF17123`	zf-RING_11	145	149	7.7e-06	26.2
TkA06G466200	`PF13639`	zf-RING_2	257	262	1.1e-12	48.8
TkA06G466200	`PF17123`	zf-RING_11	258	262	7.7e-06	26.2
TkA06G466200	`PF13923`	zf-C3HC4_2	259	266	0.0008	19.9
TkA06G466200	`PF13639`	zf-RING_2	329	371	1.1e-12	48.8
TkA06G466200	`PF17123`	zf-RING_11	329	357	7.7e-06	26.2
TkA06G466200	`PF13923`	zf-C3HC4_2	329	370	0.0008	19.9
TkA06G466200	`PF12678`	zf-rbx1	330	371	4.8e-05	24.2
TkA06G466200	`PF12861`	zf-ANAPC11	330	371	3.9	8.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LN71`	Arabidopsis thaliana	sp\|Q9LN71\|RING1_ARATH E3 ubiquitin-protein ligase At1g12760	61.200%	Swiss-Prot	High
`Q93Z92`	Arabidopsis thaliana	sp\|Q93Z92\|RING4_ARATH E3 ubiquitin-protein ligase At4g11680	62.800%	Swiss-Prot	High
`Q8LDB8`	Arabidopsis thaliana	sp\|Q8LDB8\|RING2_ARATH E3 ubiquitin-protein ligase At1g63170	59.700%	Swiss-Prot	High
`Q8GUU2`	Arabidopsis thaliana	sp\|Q8GUU2\|RIE1_ARATH E3 ubiquitin protein ligase RIE1	46.700%	Swiss-Prot	Medium
`O64763`	Arabidopsis thaliana	sp\|O64763\|ATL9_ARATH E3 ubiquitin-protein ligase ATL9	48.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card