LXL04_026748 | RubberDandelionOmics

Gene overview

LXL04_026748

Reference: OH-1004 Chr: Chr06 Coordinates: 2407260-2409700 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1212 bp · LXL04_026748|LXL04_026748|OH1004|cDNA

ATGTCAACGACGATGCCATCTCAATCTCCGTCGTCTTCCTCGGAAgacaccaccaccaccaccaccactaccACCGCCATCGATTCAACGCCGCTGCTCACCCCAACTTCCGACGGGATATCCCGCAGCCGCCAATTCGTCAGAGGCACTCCCTCCCTCCGTGGCGCCGCGAGGTTCCTCCGCCGAGCCAGCAGCCGGCGGATGCTCCGTGAGCCGTCGATGCGTGTGAGGGAATCGGCAGCTGAGCAGATCGAAGAACG...

CDS

Download CDS FASTA

1212 bp · LXL04_026748|LXL04_026748|OH1004|CDS

ATGTCAACGACGATGCCATCTCAATCTCCGTCGTCTTCCTCGGAAGACACCACCACCACCACCACCACTACCACCGCCATCGATTCAACGCCGCTGCTCACCCCAACTTCCGACGGGATATCCCGCAGCCGCCAATTCGTCAGAGGCACTCCCTCCCTCCGTGGCGCCGCGAGGTTCCTCCGCCGAGCCAGCAGCCGGCGGATGCTCCGTGAGCCGTCGATGCGTGTGAGGGAATCGGCAGCTGAGCAGATCGAAGAACG...

Protein

Download Protein FASTA

403 aa · LXL04_026748|LXL04_026748|OH1004|PROTEIN

MSTTMPSQSPSSSSEDTTTTTTTTTAIDSTPLLTPTSDGISRSRQFVRGTPSLRGAARFLRRASSRRMLREPSMRVRESAAEQIEERQTDWAYSRPIVILDLIWNLAFIVVSISVLIMSRKENPKRPLRLWIVGYACQCLLHMICVCVEYKNRYEQRSPEYGGTPRSEVSNRNSNPNSNSNSSSSGSEGENTDFALNSSQNDDDTSVAKHLESANTMFSFIWWIVGFYWVSSGGQHLTLNAPQLYWLCITFLAFDVFFVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026748`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026748

Location Chr06:2407260-2409700 (-)

Description Similar to At4g11680: E3 ubiquitin-protein ligase At4g11680

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g11680`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At1g12760`	Mediates E2-dependent protein ubiquitination in vitro.	No verified direct reference in this release
`At1g63170`	Mediates E2-dependent protein ubiquitination.	No verified direct reference in this release
`At2g01735`	Probable E3 ubiquitin-protein ligase required for embryo development.	A RING-H2 zinc-finger protein gene RIE1 is essential for seed development in Arabidopsis.2003 · DOI: 10.1023/b:plan.0000009256.01620.a6

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026748 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030178 negative regulation of Wnt signaling pathway Biological Process

GO:0038018 Wnt receptor catabolic process Biological Process

GO:0060828 regulation of canonical Wnt signaling pathway Biological Process

GO:0072089 stem cell proliferation Biological Process

GO:0090090 negative regulation of canonical Wnt signaling pathway Biological Process

GO:2000051 negative regulation of non-canonical Wnt signaling pathway Biological Process

GO:2000095 regulation of Wnt signaling pathway, planar cell polarity pathway Biological Process

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT1G12760

ath:AT1G63170

ath:AT2G01735

ath:AT4G11680

mmu:407821

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.435

Rank 1 · LXL04_026748 · OH-1004

Cytoplasm0.219

Rank 2 · LXL04_026748 · OH-1004

Cell membrane0.204

Rank 3 · LXL04_026748 · OH-1004

Endoplasmic reticulum0.186

Rank 4 · LXL04_026748 · OH-1004

Golgi apparatus0.170

Rank 5 · LXL04_026748 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2346-388 aa

PF17123.12zf-RING_11346-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026748	`PF13639.13`	zf-RING_2	346	388	1.2e-12	48.6
LXL04_026748	`PF17123.12`	zf-RING_11	346	374	3.1e-07	30.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z92`	Arabidopsis thaliana	E3 ubiquitin-protein ligase At4g11680	60.263%	Swiss-Prot	strong database homology
`Q9LN71`	Arabidopsis thaliana	E3 ubiquitin-protein ligase At1g12760	61.605%	Swiss-Prot	strong database homology
`Q8LDB8`	Arabidopsis thaliana	E3 ubiquitin-protein ligase At1g63170	60.845%	Swiss-Prot	strong database homology
`Q8GUU2`	Arabidopsis thaliana	E3 ubiquitin protein ligase RIE1	43.223%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card