TkA06G048590 | RubberDandelionOmics

Gene overview

TkA06G048590

Reference: TK1151 Chr: Chr06 Coordinates: 13182467-13190934 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6052 bp · TkA06G048590|TK1151|cDNA

CGATGACTGGATGGGGTTGGTTAGAGATGCTTATATTTGGGCTGTCAAACTCAAATCTACGAACCCAGAGATGATTTGGATGCACATTACACATTAATTACCTAACTCCACTCCACTCCCCCCACCACACCACTGAGCACCTTTGACAACTATGGCATGACGAAGCTTTAAGCATCCTCCGACTTACACCCAACTTTCCAGCTGCCATCATTTACCGACTCCTGCTACTGCTATTGCTATTGTTACTACCTTTAATGGTT...

CDS

Download CDS FASTA

5469 bp · TkA06G048590|TK1151|CDS

ATGTCATCCAATGGGCACTGTTTTAGAAGAAAACCACGCCAACCAGTTGCTGCTAATTTGGATGTTGACTCACTGCTTGATGAAAATTTAGAACAGTGGCCACATCTAAATGAACTTGTTCAATGCTACAAGACTGATTGGATTAAAGATGAAAACAAGTATGGGCACTATGAAAGTGTTGGAAGTATATCCTTTCAGAACCAGATATTTGAAGGACCTGATACCGATATTGAAACAGAAATGCATCTTGCAAATGCTAG...

Protein

Download Protein FASTA

1822 aa · TkA06G048590|TK1151|PROTEIN

MSSNGHCFRRKPRQPVAANLDVDSLLDENLEQWPHLNELVQCYKTDWIKDENKYGHYESVGSISFQNQIFEGPDTDIETEMHLANARHDKIEDITDDDVPSTSGRQLTEHYGESPLPAYEPVFDWENERSMIFGQRIPESNMPQSSSGLKISVKVLSLSFQAGLVEPFYGTISLYNKERREKLSEDFIFRVLPSEMQDASSSSESRGLFYLDAPSSSICLLIQLEKCATEEGGVTPSVYSRKEPVHLTEREKQKLQVWSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G048590`
TK1151 ID	TkA06G048590
OH-1004 ID	LXL04_025619
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 98.628 / OH-1004 97.557 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G048590

Location Chr06:13182467-13190934 (+)

Description Similar to SPK1: Guanine nucleotide exchange factor SPIKE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16340`	Guanine nucleotide exchange factor (GEF) for Rho and Rac.	SPIKE1 signals originate from and assemble specialized domains of the endoplasmic reticulum.2010 · DOI: 10.1016/j.cub.2010.11.016 A ROP GTPase-dependent auxin signaling pathway regulates the subcellular distribution of PIN2 in Arabidopsis roots.2012 · DOI: 10.1016/j.cub.2012.05.019

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025619 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007264 small GTPase-mediated signal transduction Biological Process

GO:0008064 regulation of actin polymerization or depolymerization Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0010928 regulation of auxin mediated signaling pathway Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0035023 regulation of Rho protein signal transduction Biological Process

GO:0043547 positive regulation of GTPase activity Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0048446 petal morphogenesis Biological Process

GO:0051211 anisotropic cell growth Biological Process

KEGG gene cross-reference

ath:AT4G16340

mmu:76088

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.614

Rank 1 · TkA06G048590 · TK1151

Golgi apparatus0.204

Rank 2 · TkA06G048590 · TK1151

Nucleus0.184

Rank 3 · TkA06G048590 · TK1151

Cell membrane0.147

Rank 4 · TkA06G048590 · TK1151

Lysosome / Vacuole0.124

Rank 5 · TkA06G048590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20421DHR-2_Lobe_C414-432 aa

PF14429DOCK-C2450-617 aa

PF28208TPR_DOCK9647-877 aa

PF06920DHR-2_Lobe_A1367-1520 aa

PF20422DHR-2_Lobe_B1588-1670 aa

PF20421DHR-2_Lobe_C1720-1814 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G048590	`PF20421`	DHR-2_Lobe_C	414	432	1.6e-27	96.1
TkA06G048590	`PF14429`	DOCK-C2	450	617	4.2e-33	115.6
TkA06G048590	`PF28208`	TPR_DOCK9	647	877	2.9e-62	211.2
TkA06G048590	`PF06920`	DHR-2_Lobe_A	1367	1520	1.7e-36	126.6
TkA06G048590	`PF20422`	DHR-2_Lobe_B	1588	1670	1.1e-21	77.3
TkA06G048590	`PF20421`	DHR-2_Lobe_C	1720	1814	1.6e-27	96.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8SAB7`	Arabidopsis thaliana	sp\|Q8SAB7\|SPK1_ARATH Guanine nucleotide exchange factor SPIKE 1	78.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card