RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G014640
Reference: TK1151 Chr: Chr06 Coordinates: 3902911-3907241 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3290 bp · TkA06G014640|TK1151|cDNA

AAAAGACAACAAACTTAGGAGAATTATTGATTTGTAATAAACTTGTTAAATAATTTAAACCTTGGACAAAATTTGTAATAAATGAAAGTTGGAGGGAGAGAAGGGGCATGCGTGCCAAAAAAGTGAAAGGTGGAGCTCAAAATTGTAAAAAGACAAAGACAAAATTTTCTTGATCAACCAAATGTGACGTTTGTTGGATTCGGGTATCGAAGCAACGTAATCCCAATCAAAATTTTCACTCTCTAATTTCTTTTGCAAAT...

CDS

Download CDS FASTA

2733 bp · TkA06G014640|TK1151|CDS

ATGTGTGCTATGTACGAAGATTTAAACGAAGGTGTAAAGAAAAAATGCAACAACGAAGAAGACGAGGCTTCTTCAACTTCTTCTTCAAATTCATTAGGCATGGAATCAGCAGGATATTTTTCCCCAGGTAGCGGATCAACTTCAAAAACACCAAGTCTCGATCATCTTCCAAAAGCAGCAGCAGCAGCAGCAACAACAGATAATCAAAGTATGAAATCAGAGAATTCATGTCATTCGTTAGAAGACGTGAGTGAAGTTGT...

Protein

Download Protein FASTA

910 aa · TkA06G014640|TK1151|PROTEIN

MCAMYEDLNEGVKKKCNNEEDEASSTSSSNSLGMESAGYFSPGSGSTSKTPSLDHLPKAAAAAATTDNQSMKSENSCHSLEDVSEVVKETLSVEPVWNTYKPEDREEEEEERGREVENLMKENGDLKDRLGEKDNKYQNLENKSSTRMKELEDRVVSLKIEIEELNDREHEQECKGKHDESAFKEKEGDVLKKLAECEKTLEGRIVQSMDRVQNVRMELDLLRSQNDEDRKKFLYERELEYLRIHNRDSEKKIKEKTEEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G014640
TK1151 IDTkA06G014640
OH-1004 IDLXL04_026365
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 95.789
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G014640
LocationChr06:3902911-3907241 (-)
DescriptionSimilar to CIP1: COP1-interactive protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g41790 Positive regulator of abscisic acid (ABA)-mediated signaling pathways involved in abiotic stress responses (e.g. osmotic stress) and leading to various plant adaptation (e.g. stomata closure).
Arabidopsis COP1-interacting protein 1 is a positive regulator of ABA response.2016 · DOI: 10.1016/j.bbrc.2016.06.147

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026365 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009738 abscisic acid-activated signaling pathway Biological Process
GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process
GO:0042306 regulation of protein import into nucleus Biological Process
GO:0071215 cellular response to abscisic acid stimulus Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005856 cytoskeleton Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009536 plastid Cellular Component
KEGG gene cross-reference
ath:AT5G41790
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.631
Rank 1 · TkA06G014640 · TK1151
Nucleus0.252
Rank 2 · TkA06G014640 · TK1151
Cell membrane0.098
Rank 3 · TkA06G014640 · TK1151
Mitochondrion0.078
Rank 4 · TkA06G014640 · TK1151
Golgi apparatus0.062
Rank 5 · TkA06G014640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4JZY1Arabidopsis thalianasp|F4JZY1|CIP1_ARATH COP1-interactive protein 133.300%Swiss-ProtLow

JBrowse

View in Genome Browser