LXL04_026365 | RubberDandelionOmics

Gene overview

LXL04_026365

Reference: OH-1004 Chr: Chr05 Coordinates: 125219835-125223771 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2853 bp · LXL04_026365|LXL04_026365|OH1004|cDNA

ATGGATGTTCTTCGTTCTTCTCCCTCCCAATCCCAGAAACAGATACTAAAAGAAACAAACCAAACGAAAATTTCCGAAGCTCTTCACCTCATTGAAGATTTTCACGATCAGTACCAATCAATGTGTGCTATGTACGAAGATTTAAACGAAGGTGTAAAGAAAAAATGCAACAACGAAGAAGACGAGGCTTcttcaacttcttcttcaaatTCATTAGGCATGGAATCAGCAGGATATTTTTCCCCAGGTAGCGGATCAAC...

CDS

Download CDS FASTA

2853 bp · LXL04_026365|LXL04_026365|OH1004|CDS

ATGGATGTTCTTCGTTCTTCTCCCTCCCAATCCCAGAAACAGATACTAAAAGAAACAAACCAAACGAAAATTTCCGAAGCTCTTCACCTCATTGAAGATTTTCACGATCAGTACCAATCAATGTGTGCTATGTACGAAGATTTAAACGAAGGTGTAAAGAAAAAATGCAACAACGAAGAAGACGAGGCTTCTTCAACTTCTTCTTCAAATTCATTAGGCATGGAATCAGCAGGATATTTTTCCCCAGGTAGCGGATCAAC...

Protein

Download Protein FASTA

950 aa · LXL04_026365|LXL04_026365|OH1004|PROTEIN

MDVLRSSPSQSQKQILKETNQTKISEALHLIEDFHDQYQSMCAMYEDLNEGVKKKCNNEEDEASSTSSSNSLGMESAGYFSPGSGSTSKTPSLDHLPKAAAAAATTDNQSMKSENSCHSLEDVSEVVKETLSVEPVWNTYKPEDREEEEEERGREVENLMKENGDLKDRLGEKDNKYQNLENKSSTRMKELEDRVVSLKIEIEELNDREHEQECKGKHDESAFKEKEGDVLKKLAECEKTLEGRIVQSMDRVQNVRMELD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026365`
TK1151 ID	TkA06G014640
OH-1004 ID	LXL04_026365
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 95.789 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026365

Location Chr05:125219835-125223771 (-)

Description Similar to CIP1: COP1-interactive protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g41790`	Positive regulator of abscisic acid (ABA)-mediated signaling pathways involved in abiotic stress responses (e.g. osmotic stress) and leading to various plant adaptation (e.g. stomata closure).	Arabidopsis COP1-interacting protein 1 is a positive regulator of ABA response.2016 · DOI: 10.1016/j.bbrc.2016.06.147

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026365 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0042306 regulation of protein import into nucleus Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G41790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.623

Rank 1 · LXL04_026365 · OH-1004

Nucleus0.256

Rank 2 · LXL04_026365 · OH-1004

Cell membrane0.106

Rank 3 · LXL04_026365 · OH-1004

Mitochondrion0.070

Rank 4 · LXL04_026365 · OH-1004

Golgi apparatus0.068

Rank 5 · LXL04_026365 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JZY1`	Arabidopsis thaliana	COP1-interactive protein 1	29.949%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card