TkA04G102450 | RubberDandelionOmics

Gene overview

TkA04G102450

Reference: TK1151 Chr: Chr04 Coordinates: 26630301-26635042 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2640 bp · TkA04G102450|TK1151|cDNA

ATAAACTAAGAAGTGAAAATTATTGCCCTTCTTCTATTGAGCATCTATTTCCAAAACGCTATCTCGCTGCTCGCTATGATGTTGTGCATCCGTAGCCACGTCCGGCGAGAGCTTTTCTCAAACTATCACTTCAGATCTCAACTTTGTTACTCAACATCAACAGCAGCTCAACTTTCGGCCAATGATGAATCTGCATCTGCCAAAAGAACCGAATTCGTCGATTATCTCATCAACACACTCGGATTCTCCAAAGAATCCGC...

CDS

Download CDS FASTA

1227 bp · TkA04G102450|TK1151|CDS

ATGATGTTGTGCATCCGTAGCCACGTCCGGCGAGAGCTTTTCTCAAACTATCACTTCAGATCTCAACTTTGTTACTCAACATCAACAGCAGCTCAACTTTCGGCCAATGATGAATCTGCATCTGCCAAAAGAACCGAATTCGTCGATTATCTCATCAACACACTCGGATTCTCCAAAGAATCCGCCATTTCCTCCTTATCAAAGGTACGCCGTCTCCACACCATTCGACATTGTGATTCAGCTATTCGTATCCTCAAAAA...

Protein

Download Protein FASTA

408 aa · TkA04G102450|TK1151|PROTEIN

MMLCIRSHVRRELFSNYHFRSQLCYSTSTAAQLSANDESASAKRTEFVDYLINTLGFSKESAISSLSKVRRLHTIRHCDSAIRILKNCGFDNAQIKDIVSWVPKVLLYKPNETLEPKIKVFLELGLSGSDLISLLKRNPCLFELGLHSRIIPTIEYLRNLLGTNEKVVETINKSRWLFSTSVALKMFADNAILLQSYGLSNDQIGKFVHKNAMHFTQPPDWLTSKLNWIEGKVGVSRDSNEFFRCFHAIASSSIVGMEKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G102450`
TK1151 ID	TkA04G102450
OH-1004 ID	LXL04_035856
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.500
Protein coverage (%)	TK1151 92.402 / OH-1004 31.234 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G102450`
Location	Chr04:26630301-26635042 (-)
Description	Similar to MTERF5: Transcription termination factor MTERF5, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035856` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006353 DNA-templated transcription termination Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006970 response to osmotic stress Biological Process GO:0009651 response to salt stress Biological Process GO:0009658 chloroplast organization Biological Process GO:0009737 response to abscisic acid Biological Process GO:0042793 plastid transcription Biological Process GO:0005739 mitochondrion Cellular Component GO:0009506 plasmodesma Cellular Component GO:0009507 chloroplast Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:1990837 sequence-specific double-stranded DNA binding Molecular Function
KEGG gene cross-reference	ath:AT2G21710 ath:AT4G14605 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.764

Rank 1 · TkA04G102450 · TK1151

Plastid0.153

Rank 2 · TkA04G102450 · TK1151

Cytoplasm0.041

Rank 3 · TkA04G102450 · TK1151

Nucleus0.038

Rank 4 · TkA04G102450 · TK1151

Cell membrane0.009

Rank 5 · TkA04G102450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02909TetR_C_144-67 aa

PF02909TetR_C_174-99 aa

PF02536mTERF83-358 aa

PF02909TetR_C_1247-273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G102450	`PF02909`	TetR_C_1	44	67	0.22	12.1
TkA04G102450	`PF02909`	TetR_C_1	74	99	0.22	12.1
TkA04G102450	`PF02536`	mTERF	83	358	3.6e-37	128.7
TkA04G102450	`PF02909`	TetR_C_1	247	273	0.22	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card