Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2814 bp · TkA02G532570|TK1151|cDNA
GTGATCATTAACTTTTTTTTCTGGCTTAATGTAAACAAAACACTGGTTTCGTTTCCGACTTTCCGTCCTACCTTCCAGTCCAGTATTTTGAAACAAGCGCTTGCATCTTACGGTAAAACGAACCTCCCCGTCCTTTCTCTCCAAAGGGGTGTAGGGTTTTAGGGGAAGAAGGCGATGCTCACTCCAATAATCCCAACACACAACAACAGGGTCGCTGATTCAACTCACCACCGACTACTCGAAGTCGTTAAGACAGCTCT...
1083 bp · TkA02G532570|TK1151|CDS
ATGCTCACTCCAATAATCCCAACACACAACAACAGGGTCGCTGATTCAACTCACCACCGACTACTCGAAGTCGTTAAGACAGCTCTTATCAAGATTTTCGTATCTCCCTACGCCACTGTGTGTGATTTGTACTGCGGAAGAGTACCAGATGAAGAGAGGTGGGACGAAGCTCAAATAGGGCACTTCATCGGAATTGATGACGCATCATCTGGAATTAGAGAAGTCCGAGAAGCATGGGAGAGTCAACGCAAGACCTACAC...
Protein
Download Protein FASTA360 aa · TkA02G532570|TK1151|PROTEIN
MLTPIIPTHNNRVADSTHHRLLEVVKTALIKIFVSPYATVCDLYCGRVPDEERWDEAQIGHFIGIDDASSGIREVREAWESQRKTYTSDFYEIDPCIENLEPNLGDKGNTADVVCCMQHLQFCFETEEKVRRLVHNVSSLLKPGGYLIGITLDSSTIWAKYQKNVEAYHNRSGAMKPNLVPNCIRSENYMITFEVEDEKFPFFGKKYQMKFANDTSAETHCLVHFPSLIRLAREAGLEYVEIQNLLEFYDDNRAQFSGML...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA02G532570 |
|---|---|
| TK1151 ID | TkA02G532570 |
| OH-1004 ID | LXL04_016415 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 28.300 |
| Protein coverage (%) | TK1151 74.444 / OH-1004 72.432Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA02G532570 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:137269688-137274206 (-) | ||||||||||||
| Description | Similar to At3g20650: mRNA cap guanine-N7 methyltransferase 1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0006370 7-methylguanosine mRNA capping Biological Process GO:0005634 nucleus Cellular Component GO:0070693 P-TEFb-cap methyltransferase complex Cellular Component GO:0160130 mRNA cap methyltransferase RNMT:RAMAC complex Cellular Component GO:0003723 RNA binding Molecular Function GO:0004482 mRNA 5'-cap (guanine-N7-)-methyltransferase activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT3G20650 cnb:CNBC5820 dosa:Os08g0180000 dre:562801 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03291mRNA_G-N7_MeTrfase23-292 aaPF13649Methyltransf_2542-145 aaPF11947DUF346453-83 aaPF08241Methyltransf_1160-148 aaPF13489Methyltransf_2384-241 aaPF08242Methyltransf_1284-147 aaPF01234NNMT_PNMT_TEMT110-155 aaPF09278MerR-DNA-bind228-254 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA02G532570 | PF03291 | mRNA_G-N7_MeTrfase | 23 | 292 | 1.6e-31 | 110.3 |
| TkA02G532570 | PF13649 | Methyltransf_25 | 42 | 145 | 0.00097 | 20.5 |
| TkA02G532570 | PF11947 | DUF3464 | 53 | 83 | 0.06 | 13.8 |
| TkA02G532570 | PF08241 | Methyltransf_11 | 60 | 148 | 0.00063 | 21.0 |
| TkA02G532570 | PF13489 | Methyltransf_23 | 84 | 241 | 0.00017 | 22.1 |
| TkA02G532570 | PF08242 | Methyltransf_12 | 84 | 147 | 0.00063 | 21.1 |
| TkA02G532570 | PF01234 | NNMT_PNMT_TEMT | 110 | 155 | 0.0033 | 17.4 |
| TkA02G532570 | PF09278 | MerR-DNA-bind | 228 | 254 | 0.024 | 15.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.