LXL04_016415 | RubberDandelionOmics

Gene overview

LXL04_016415

Reference: OH-1004 Chr: Chr03 Coordinates: 122124344-122126885 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · LXL04_016415|LXL04_016415|OH1004|cDNA

ATGAAGAGAAGTTATCAGCACTCATCCTCCTCGGGCTCTTATGGACCTCCCAAATCCAAATCCAGACACAATTCAGACGGTGATGCTTTTCTAGAAGACGAGAGTACAAAGATTTTTGCCAAAAAAGTTGCAGACCATTACAGCGCAAGGACAAACCAAACCTTGGAAGAGCGTGAAGCTAGTCCCATTATCCATTTAAAGAAACTCAATAATTGGATTAAAAGTGTTCTAATTCAACTATATGCAAAAAAGGGGGATGC...

CDS

Download CDS FASTA

1113 bp · LXL04_016415|LXL04_016415|OH1004|CDS

ATGAAGAGAAGTTATCAGCACTCATCCTCCTCGGGCTCTTATGGACCTCCCAAATCCAAATCCAGACACAATTCAGACGGTGATGCTTTTCTAGAAGACGAGAGTACAAAGATTTTTGCCAAAAAAGTTGCAGACCATTACAGCGCAAGGACAAACCAAACCTTGGAAGAGCGTGAAGCTAGTCCCATTATCCATTTAAAGAAACTCAATAATTGGATTAAAAGTGTTCTAATTCAACTATATGCAAAAAAGGGGGATGC...

Protein

Download Protein FASTA

370 aa · LXL04_016415|LXL04_016415|OH1004|PROTEIN

MKRSYQHSSSSGSYGPPKSKSRHNSDGDAFLEDESTKIFAKKVADHYSARTNQTLEEREASPIIHLKKLNNWIKSVLIQLYAKKGDAVLDLACGKGGDLIKWDKAKIGYYVGIDIADGSIEDCRTRYNGDADHHQRRKKFTFPARLLNGDCFEVRLDKALADDAPFDLCSCQFAMHYSWSTEARARRALANVSSLLRPGGIFIGTMPDANVIVKKLRAADGLAFGNSVYWIHFDDEFSEKKFKSSSPFGIKYKFHLEDAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016415`
TK1151 ID	TkA02G532570
OH-1004 ID	LXL04_016415
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	28.300
Protein coverage (%)	TK1151 74.444 / OH-1004 72.432 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016415

Location Chr03:122124344-122126885 (+)

Description Similar to At3g20650: mRNA cap guanine-N7 methyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20650`	mRNA-capping methyltransferase that methylates the N7 position of the added guanosine to the 5'-cap structure of mRNAs.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0180000`	mRNA-capping methyltransferase that methylates the N7 position of the added guanosine to the 5'-cap structure of mRNAs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016415 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006370 7-methylguanosine mRNA capping Biological Process

GO:0005634 nucleus Cellular Component

GO:0070693 P-TEFb-cap methyltransferase complex Cellular Component

GO:0160130 mRNA cap methyltransferase RNMT:RAMAC complex Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004482 mRNA 5'-cap (guanine-N7-)-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G20650

cnb:CNBC5820

dosa:Os08g0180000

dre:562801

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.747

Rank 1 · LXL04_016415 · OH-1004

Cytoplasm0.354

Rank 2 · LXL04_016415 · OH-1004

Cell membrane0.047

Rank 3 · LXL04_016415 · OH-1004

Endoplasmic reticulum0.032

Rank 4 · LXL04_016415 · OH-1004

Mitochondrion0.026

Rank 5 · LXL04_016415 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03291.23mRNA_G-N7_MeTrfase32-341 aa

PF13847.13Methyltransf_3183-208 aa

PF13649.13Methyltransf_2588-200 aa

PF08242.19Methyltransf_1289-202 aa

PF08241.19Methyltransf_1189-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016415	`PF03291.23`	mRNA_G-N7_MeTrfase	32	341	8.3e-128	426.6
LXL04_016415	`PF13847.13`	Methyltransf_31	83	208	7.9e-10	39.4
LXL04_016415	`PF13649.13`	Methyltransf_25	88	200	2.9e-10	41.4
LXL04_016415	`PF08242.19`	Methyltransf_12	89	202	2.3e-10	41.8
LXL04_016415	`PF08241.19`	Methyltransf_11	89	203	2.3e-08	35.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHQ7`	Arabidopsis thaliana	mRNA cap guanine-N(7) methyltransferase 1	81.143%	Swiss-Prot	strong database homology
`Q6Z9U7`	Oryza sativa subsp. japonica	mRNA cap guanine-N(7) methyltransferase 1	78.116%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card