TkA02G443530 | RubberDandelionOmics

Gene overview

TkA02G443530

Reference: TK1151 Chr: Chr02 Coordinates: 112749026-112752871 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1758 bp · TkA02G443530|TK1151|cDNA

ATGTCATCGATGTATCGTTTTCTGAGCGATCTAAAACCTGAGTTAACCGATAAATGGAAAGTTCATGTCATGGTCAGTCGTAAATGGAGAACATTCAATCCGAGGAGTGGGAAAATACTCTCTGCTGACCTGATATTAACTGATGAACGTAACCGATCGATCCATGCCGGGATTCCCGAGTCATTGATGGAATGTTTTTACCACAAATTGACAGAAGGAGTGGTTTATCAGATTCATCAGTTTGAGGTAAAGGTGTATCG...

CDS

Download CDS FASTA

1758 bp · TkA02G443530|TK1151|CDS

ATGTCATCGATGTATCGTTTTCTGAGCGATCTAAAACCTGAGTTAACCGATAAATGGAAAGTTCATGTCATGGTCAGTCGTAAATGGAGAACATTCAATCCGAGGAGTGGGAAAATACTCTCTGCTGACCTGATATTAACTGATGAACGTAACCGATCGATCCATGCCGGGATTCCCGAGTCATTGATGGAATGTTTTTACCACAAATTGACAGAAGGAGTGGTTTATCAGATTCATCAGTTTGAGGTAAAGGTGTATCG...

Protein

Download Protein FASTA

585 aa · TkA02G443530|TK1151|PROTEIN

MSSMYRFLSDLKPELTDKWKVHVMVSRKWRTFNPRSGKILSADLILTDERNRSIHAGIPESLMECFYHKLTEGVVYQIHQFEVKVYRTQYRPLNRDMFIKLLRRTSIRASHIPATALQRYCFDFIAYGALQSRVYEHTYLSDVIGYLREWSFVKQTGDTSRSNVRQIILSDESHTEINVSLWGNLATKFTDEHIRSLNDKKILGVLSVPALHTTCASDIYLNIPLNEMPILNTIVTERVRFKLKEDIVEETVLVTTIPDL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G443530`
TK1151 ID	TkA02G443530
OH-1004 ID	LXL04_037670
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	92.500
Protein coverage (%)	TK1151 87.179 / OH-1004 79.448 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G443530`
Location	Chr02:112749026-112752871 (+)
Description	No functional description available
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037670` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000723 telomere maintenance Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006260 DNA replication Biological Process GO:0006281 DNA repair Biological Process GO:0006289 nucleotide-excision repair Biological Process GO:0006312 mitotic recombination Biological Process GO:0007004 telomere maintenance via telomerase Biological Process GO:0007140 male meiotic nuclear division Biological Process GO:0010224 response to UV-B Biological Process GO:0033260 nuclear DNA replication Biological Process GO:0051321 meiotic cell cycle Biological Process GO:0000785 chromatin Cellular Component
KEGG gene cross-reference	ath:AT5G08020 ath:AT5G45400 ath:AT5G61000 dosa:Os03g0214100 spo:2541158 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.944

Rank 1 · TkA02G443530 · TK1151

Cytoplasm0.127

Rank 2 · TkA02G443530 · TK1151

Cell membrane0.023

Rank 3 · TkA02G443530 · TK1151

Mitochondrion0.016

Rank 4 · TkA02G443530 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA02G443530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02721DUF2239-112 aa

PF08646Rep_fac-A_C68-91 aa

PF28721DUF8448134-202 aa

PF16900REPA_OB_2139-192 aa

PF02721DUF223166-191 aa

PF13192Thioredoxin_3195-211 aa

PF08646Rep_fac-A_C276-378 aa

PF25299ZZ_ADA2284-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G443530	`PF02721`	DUF223	9	112	2.8e-11	44.3
TkA02G443530	`PF08646`	Rep_fac-A_C	68	91	2.8e-11	44.1
TkA02G443530	`PF28721`	DUF8448	134	202	0.091	13.5
TkA02G443530	`PF16900`	REPA_OB_2	139	192	4e-05	24.2
TkA02G443530	`PF02721`	DUF223	166	191	2.8e-11	44.3
TkA02G443530	`PF13192`	Thioredoxin_3	195	211	0.072	13.8
TkA02G443530	`PF08646`	Rep_fac-A_C	276	378	2.8e-11	44.1
TkA02G443530	`PF25299`	ZZ_ADA2	284	312	0.18	12.7
TkA02G443530	`PF13192`	Thioredoxin_3	300	349	0.072	13.8
TkA02G443530	`PF02721`	DUF223	451	473	2.8e-11	44.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card