RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G608510
Reference: TK1151 Chr: Chr01 Coordinates: 153386275-153390880 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3693 bp · TkA01G608510|TK1151|cDNA

AAAAGGGGAGCTCGCTTTCCTTGATATATATAAACTAATTGATCGATTAAATAAAATTTAACGAAGCTTCAAGGAAATCAGGAGCCCTTACTTGTCTATCAAACCAACTCGAATAAGTGCTTAGCGAAAAGGGATTCTTTCTTCGTAGATCTGTTCCCTCATTCTCACTCAAAATCTTGAAAACGAAGTTCTTTCATCTCTCTAGAGAGAAATCGAACCTGAAACTTTAGAAAAGAGCATCACTTGCTCTACATATATGT...

CDS

Download CDS FASTA

3189 bp · TkA01G608510|TK1151|CDS

ATGGGTAAAGGAGCCCAAAATTCCGGTAGGAAAGACAGTACAGACAAATCATCACTGGATCGCAACCAATATGCTGCCTGGGCAAAGGACGTTCATGAATGTGAACAAAACTACCAGGTAGACAGCAAATCCGGTCTATCTGATAGTGAAGTAGAGAAGCGGCTGAAAAAGTATGGCACAAACGAGTTGGAAAAGCATGAAGGACAATCTGTTTTCCGTCTAATTCTAGATCAATTCAACGACACTTTAGTTAGAATCTT...

Protein

Download Protein FASTA

1062 aa · TkA01G608510|TK1151|PROTEIN

MGKGAQNSGRKDSTDKSSLDRNQYAAWAKDVHECEQNYQVDSKSGLSDSEVEKRLKKYGTNELEKHEGQSVFRLILDQFNDTLVRILLAAAVISFVLAWYDGEEGGEMEITAFVEPLVIFLILIVNAIVGVWQESNAEKALEALKEIQSQQATVIRNGRKLSSLPAKELVPGDIVELRVGDKIPADLRVITLISSTLRVEQGSLTGESEAVSKTTKPVPEETDIQGKKCMVFAGTTVVNGHCLCMVTDTGMNTEIGKVHS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G608510
TK1151 IDTkA01G608510
OH-1004 IDLXL04_000496
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.900
Protein coverage (%)TK1151 99.153 / OH-1004 97.772
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G608510
LocationChr01:153386275-153390880 (+)
DescriptionSimilar to ECA1: Calcium-transporting ATPase 1, endoplasmic reticulum-type
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g07810 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the endoplasmic reticulum lumen. No verified direct reference in this release
At1g07670 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to an endomembrane compartment. No verified direct reference in this release
At4g00900 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to an endomembrane compartment. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000496 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006816 calcium ion transport Biological Process
GO:0006874 intracellular calcium ion homeostasis Biological Process
GO:0010042 response to manganese ion Biological Process
GO:0070588 calcium ion transmembrane transport Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0005388 P-type calcium transporter activity Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT1G07670
ath:AT1G07810
ath:AT4G00900
sly:543554
tgo:TGME49_230420
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.392
Rank 1 · TkA01G608510 · TK1151
Cell membrane0.272
Rank 2 · TkA01G608510 · TK1151
Golgi apparatus0.180
Rank 3 · TkA01G608510 · TK1151
Cytoplasm0.114
Rank 4 · TkA01G608510 · TK1151
Lysosome / Vacuole0.090
Rank 5 · TkA01G608510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00690Cation_ATPase_N27-94 aa
PF00689Cation_ATPase_C100-100 aa
PF00690Cation_ATPase_N112-123 aa
PF00122E1-E2_ATPase147-262 aa
PF12710HAD185-207 aa
PF00689Cation_ATPase_C287-303 aa
PF00702Hydrolase379-408 aa
PF13246Cation_ATPase437-636 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G608510PF00690Cation_ATPase_N27942.9e-2175.6
TkA01G608510PF00689Cation_ATPase_C1001001.9e-47162.0
TkA01G608510PF00690Cation_ATPase_N1121232.9e-2175.6
TkA01G608510PF00122E1-E2_ATPase1472623.8e-2588.3
TkA01G608510PF12710HAD1852071.6e-0629.4
TkA01G608510PF00689Cation_ATPase_C2873031.9e-47162.0
TkA01G608510PF00702Hydrolase3794084e-1867.2
TkA01G608510PF13246Cation_ATPase4376365.5e-39134.6
TkA01G608510PF08282Hydrolase_35185828.2e-0729.7
TkA01G608510PF00702Hydrolase6257454e-1867.2
TkA01G608510PF12710HAD6327421.6e-0629.4
TkA01G608510PF08282Hydrolase_36356708.2e-0729.7
TkA01G608510PF08282Hydrolase_37197748.2e-0729.7
TkA01G608510PF00689Cation_ATPase_C81710421.9e-47162.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P92939Arabidopsis thalianasp|P92939|ECA1_ARATH Calcium-transporting ATPase 1, endoplasmic reticulum-type78.900%Swiss-ProtHigh
Q9XES1Arabidopsis thalianasp|Q9XES1|ECA4_ARATH Calcium-transporting ATPase 4, endoplasmic reticulum-type79.100%Swiss-ProtHigh
O23087Arabidopsis thalianasp|O23087|ECA2_ARATH Calcium-transporting ATPase 2, endoplasmic reticulum-type64.500%Swiss-ProtHigh

JBrowse

View in Genome Browser