RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA01G596250
Reference: TK1151 Chr: Chr01 Coordinates: 150124867-150128554 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3446 bp · TkA01G596250|TK1151|cDNA

TTGAAATTCACTGTCGTTATCTTATATTAATAACTCTATTGAAAAAATAACCTAAAAGATTTGCACCCACAAATATTTTCTAGATTTTTTTAATAATGTTGATTGAAAATAAACTATAATTAAAATCCCCTTAAGCATGTTATTTCTTTTTCTCTCTCTTTCTCTCTCATACAATCACGGATGCACGCAGCAGCAAGGTTCTGCGTCAATGGTGGTGACCGCCGGCTAGGTTTAATTTAACCCACACTTTCATCAACACC...

CDS

Download CDS FASTA

2871 bp · TkA01G596250|TK1151|CDS

ATGTCGATCTCAAACGCTACTCATGATGGGTGTTCATCATCATCACCAAGATCAGCGAAAATCGCGAATCTGATCCGTCATTTTACAAACACCATGAAATCCGGCGGTCTTAAGTTCAAAGACCGGTGTAAAAAACCCACACAAGTACACGCCCTTACCATCAACTCCATTTTGTCATCATCATCATCATCGAACAGTGATGAATCGTCAACGCTCCCATTCGTCAATGCTAAATCGCTTCTTCCTTATGGGCTCCCTAA...

Protein

Download Protein FASTA

956 aa · TkA01G596250|TK1151|PROTEIN

MSISNATHDGCSSSSPRSAKIANLIRHFTNTMKSGGLKFKDRCKKPTQVHALTINSILSSSSSSNSDESSTLPFVNAKSLLPYGLPNTHLIEPPIDPHLNPLDFINSISDLYRRITHSSSESESCRLYLEQYALFCAVGDPKLLRRSLQSAREHAVDIHSKVVLSAWLRYERREDELVGISAMDCIGKVLECPKSALSNNVYDPSHSVFDRCQCVDENASDNLNVAGPLTSLDDEFLVHGNDDEIVWFCIGYEVITCLRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA01G596250
TK1151 IDTkA01G596250
OH-1004 IDLXL04_000648
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.600
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA01G596250
LocationChr01:150124867-150128554 (-)
DescriptionSimilar to ETO1: Ethylene-overproduction protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g51770 Essential regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.
Regulation of ethylene gas biosynthesis by the Arabidopsis ETO1 protein.2004 · DOI: 10.1038/nature02516
Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases.2005 · DOI: 10.1186/1471-2229-5-14
The BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels.2009 · DOI: 10.1111/j.1365-313x.2008.03693.x
At5g58550 Potential regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.
The BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels.2009 · DOI: 10.1111/j.1365-313x.2008.03693.x
At4g02680 Possible regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_000648 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009873 ethylene-activated signaling pathway Biological Process
GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process
GO:0010182 sugar mediated signaling pathway Biological Process
GO:0010364 regulation of ethylene biosynthetic process Biological Process
GO:0016036 cellular response to phosphate starvation Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0017145 stem cell division Biological Process
GO:0035864 response to potassium ion Biological Process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process
GO:0046683 response to organophosphorus Biological Process
GO:2000069 regulation of post-embryonic root development Biological Process
GO:0005634 nucleus Cellular Component
KEGG gene cross-reference
ath:AT3G51770
ath:AT4G02680
ath:AT5G58550
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.559
Rank 1 · TkA01G596250 · TK1151
Nucleus0.422
Rank 2 · TkA01G596250 · TK1151
Mitochondrion0.099
Rank 3 · TkA01G596250 · TK1151
Cell membrane0.042
Rank 4 · TkA01G596250 · TK1151
Endoplasmic reticulum0.036
Rank 5 · TkA01G596250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30484ETO1_C103-173 aa
PF24575TPR_Slam110-129 aa
PF30481ETO1_N119-179 aa
PF30484ETO1_C406-610 aa
PF24575TPR_Slam409-467 aa
PF29407CFAP70_TPR_C429-492 aa
PF13431TPR_17447-462 aa
PF00515TPR_1448-474 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA01G596250PF30484ETO1_C1031737.6e-190630.6
TkA01G596250PF24575TPR_Slam1101290.3112.2
TkA01G596250PF30481ETO1_N1191792e-2176.5
TkA01G596250PF30484ETO1_C4066107.6e-190630.6
TkA01G596250PF24575TPR_Slam4094670.3112.2
TkA01G596250PF29407CFAP70_TPR_C4294924.9e-0523.7
TkA01G596250PF13431TPR_174474620.2112.7
TkA01G596250PF00515TPR_14484749.9e-1554.4
TkA01G596250PF07719TPR_24484746.6e-1348.4
TkA01G596250PF13181TPR_84484756.6e-0832.8
TkA01G596250PF13424TPR_124485044.4e-0627.5
TkA01G596250PF13374TPR_104484754.5e-0524.0
TkA01G596250PF13371TPR_94494750.6110.9
TkA01G596250PF13414TPR_114554721.6e-0525.2
TkA01G596250PF25062ARM_TT21_N4575080.949.9
TkA01G596250PF13428TPR_144845099.9e-0523.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O65020Arabidopsis thalianasp|O65020|ETO1_ARATH Ethylene-overproduction protein 160.000%Swiss-ProtHigh
Q9LV01Arabidopsis thalianasp|Q9LV01|ETOL2_ARATH ETO1-like protein 255.800%Swiss-ProtHigh
Q9ZQX6Arabidopsis thalianasp|Q9ZQX6|ETOL1_ARATH ETO1-like protein 149.300%Swiss-ProtMedium

JBrowse

View in Genome Browser