LXL04_000648 | RubberDandelionOmics

Gene overview

LXL04_000648

Reference: OH-1004 Chr: Chr01 Coordinates: 11938487-11941608 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2871 bp · LXL04_000648|LXL04_000648|OH1004|cDNA

ATGTCGATCTCAAACGCTACTCATGATGGGTGTTCATCATCATCACCAAGATCAGCGAAAATCGCGAATCTGATCCGTCATTTTACAAACACCATGAAATCCGGCGGTCTTAAGTTCAAAGACCGGTGTAAAAAACCCACACAAGTACACGCCCTTACCATCAACTCCATTTtgtcatcatcatcatcatcgaaCAGTGATGAATCGTCAACGCTCCCATTCGTCAATGCTAAATCGCTTCTTCCTTATGGGCTCCCTAA...

CDS

Download CDS FASTA

2871 bp · LXL04_000648|LXL04_000648|OH1004|CDS

ATGTCGATCTCAAACGCTACTCATGATGGGTGTTCATCATCATCACCAAGATCAGCGAAAATCGCGAATCTGATCCGTCATTTTACAAACACCATGAAATCCGGCGGTCTTAAGTTCAAAGACCGGTGTAAAAAACCCACACAAGTACACGCCCTTACCATCAACTCCATTTTGTCATCATCATCATCATCGAACAGTGATGAATCGTCAACGCTCCCATTCGTCAATGCTAAATCGCTTCTTCCTTATGGGCTCCCTAA...

Protein

Download Protein FASTA

956 aa · LXL04_000648|LXL04_000648|OH1004|PROTEIN

MSISNATHDGCSSSSPRSAKIANLIRHFTNTMKSGGLKFKDRCKKPTQVHALTINSILSSSSSSNSDESSTLPFVNAKSLLPYGLPNTHLIEPPIDPHLNPLDFINSISDLYRRITHSSSESESCRLYLEQYALFCAVGDPKLLRRSLQSAREHAVDIHSKVVLSAWLRYERREDELVGISAMDCIGKVLECPKSALSNNVYDPSHSVFDRCQCVDENASDNLNVAGPLTSLDDEFLVHGNDDEIVWFCIGNEVITCLRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000648`
TK1151 ID	TkA01G596250
OH-1004 ID	LXL04_000648
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000648

Location Chr01:11938487-11941608 (+)

Description Similar to ETO1: Ethylene-overproduction protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51770`	Essential regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.	Regulation of ethylene gas biosynthesis by the Arabidopsis ETO1 protein.2004 · DOI: 10.1038/nature02516 Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases.2005 · DOI: 10.1186/1471-2229-5-14 The BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels.2009 · DOI: 10.1111/j.1365-313x.2008.03693.x
`At5g58550`	Potential regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.	The BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels.2009 · DOI: 10.1111/j.1365-313x.2008.03693.x
`At4g02680`	Possible regulator of the ethylene pathway, which acts by regulating the stability of 1-aminocyclopropane-1-carboxylate synthase (ACS) enzymes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000648 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:0010364 regulation of ethylene biosynthetic process Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0017145 stem cell division Biological Process

GO:0035864 response to potassium ion Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0046683 response to organophosphorus Biological Process

GO:2000069 regulation of post-embryonic root development Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G51770

ath:AT4G02680

ath:AT5G58550

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.562

Rank 1 · LXL04_000648 · OH-1004

Nucleus0.420

Rank 2 · LXL04_000648 · OH-1004

Mitochondrion0.103

Rank 3 · LXL04_000648 · OH-1004

Cell membrane0.042

Rank 4 · LXL04_000648 · OH-1004

Endoplasmic reticulum0.036

Rank 5 · LXL04_000648 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30484.1ETO1_C103-173 aa

PF30481.1ETO1_N119-179 aa

PF30484.1ETO1_C406-610 aa

PF30484.1ETO1_C635-951 aa

PF00515.35TPR_1777-807 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000648	`PF30484.1`	ETO1_C	103	173	3.3e-190	631.8
LXL04_000648	`PF30481.1`	ETO1_N	119	179	2e-21	76.5
LXL04_000648	`PF30484.1`	ETO1_C	406	610	3.3e-190	631.8
LXL04_000648	`PF30484.1`	ETO1_C	635	951	3.3e-190	631.8
LXL04_000648	`PF00515.35`	TPR_1	777	807	9.7e-15	54.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65020`	Arabidopsis thaliana	Ethylene-overproduction protein 1	60.067%	Swiss-Prot	strong database homology
`Q9LV01`	Arabidopsis thaliana	ETO1-like protein 2	55.664%	Swiss-Prot	strong database homology
`Q9ZQX6`	Arabidopsis thaliana	ETO1-like protein 1	49.360%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card