TkA01G323230 | RubberDandelionOmics

Gene overview

TkA01G323230

Reference: TK1151 Chr: Chr01 Coordinates: 80444290-80446819 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2215 bp · TkA01G323230|TK1151|cDNA

AACCAAGAAAAGTTGGGTTGTGGGAAAGAGTTAAATGACGTGCTTCCTTCTAAACCAGAAAAAAGCCGTTGTTTGGCACCCGGTCATCGTCGTTATCGAGGAACCAAAAAGAGGACTCACAGACACGATTTTCTTGTTTCCCTCTTCACTGAAACCCTCACCAACAACTTCAATGGAGGTTCATATGCATACTCGATCGCCTTACCATCTTACTCTTATATTCCCCAAAAGCAGTATTAAGATCTCCACGAAGTTCCCTT...

CDS

Download CDS FASTA

1932 bp · TkA01G323230|TK1151|CDS

ATGACGTGCTTCCTTCTAAACCAGAAAAAAGCCGTTGTTTGGCACCCGGTCATCGTCGTTATCGAGGAACCAAAAAGAGGACTCACAGACACGATTTTCTTGTTTCCCTCTTCACTGAAACCCTCACCAACAACTTCAATGGAGGTTCATATGCATACTCGATCGCCTTACCATCTTACTCTTATATTCCCCAAAAGCAGTATTAAGATCTCCACGAAGTTCCCTTTTCTTCTTCAAACCTCAACCACCTCCCGTCGACT...

Protein

Download Protein FASTA

643 aa · TkA01G323230|TK1151|PROTEIN

MTCFLLNQKKAVVWHPVIVVIEEPKRGLTDTIFLFPSSLKPSPTTSMEVHMHTRSPYHLTLIFPKSSIKISTKFPFLLQTSTTSRRLHYTSLFVAATRAPLPLPLPLPPTSVVPLEQPGGKMVVELVGTFNELTERMKNNNNQLLSTSSSRLLFKTLKLCLPILQTLPLAPDGRSPLSRALSAAILLADLQMDAEVISVGILREALEANAISMYQVKDRIGISTAHLLHETLRVKNMSSKVDIYDEETTSALRKFCLTYY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G323230`
TK1151 ID	TkA01G323230
OH-1004 ID	LXL04_003672
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 94.712 / OH-1004 96.361 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G323230

Location Chr01:80444290-80446819 (-)

Description Similar to CRSH: Probable GTP diphosphokinase CRSH, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17470`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	The bacterial stringent response, conserved in chloroplasts, controls plant fertilization.2008 · DOI: 10.1093/pcp/pcm177 Expression profiling of four RelA/SpoT-like proteins, homologues of bacterial stringent factors, in Arabidopsis thaliana.2008 · DOI: 10.1007/s00425-008-0758-5

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0161200`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200
`Os05g0161800`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200
`Os05g0161500`	Possesses calcium-dependent ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase activity in vitro and is able to functionally complement E.coli relA mutants.	Calcium-activated (p)ppGpp synthetase in chloroplasts of land plants.2007 · DOI: 10.1074/jbc.m703820200
`Os09g0442600`	Probable ppGpp (guanosine 3'-diphosphate 5'-diphosphate) synthetase that may be involved in a rapid plant ppGpp-mediated response to pathogens and other stresses.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003672 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015969 guanosine tetraphosphate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005509 calcium ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0008728 GTP diphosphokinase activity Molecular Function

GO:0016301 kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G17470

dosa:Os05g0161200

dosa:Os05g0161500

dosa:Os05g0161800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.952

Rank 1 · TkA01G323230 · TK1151

Mitochondrion0.056

Rank 2 · TkA01G323230 · TK1151

Nucleus0.029

Rank 3 · TkA01G323230 · TK1151

Cytoplasm0.027

Rank 4 · TkA01G323230 · TK1151

Peroxisome0.017

Rank 5 · TkA01G323230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13328HD_4117-139 aa

PF29176Allatotropin-like_C130-140 aa

PF13328HD_4170-307 aa

PF17959EF-hand_14243-280 aa

PF22560GMT-wHTH341-386 aa

PF04607RelA_SpoT373-498 aa

PF04607RelA_SpoT506-535 aa

PF23564EF-hand_FSTL1532-563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G323230	`PF13328`	HD_4	117	139	5.8e-21	75.6
TkA01G323230	`PF29176`	Allatotropin-like_C	130	140	0.015	15.5
TkA01G323230	`PF13328`	HD_4	170	307	5.8e-21	75.6
TkA01G323230	`PF17959`	EF-hand_14	243	280	0.12	13.4
TkA01G323230	`PF22560`	GMT-wHTH	341	386	0.057	14.5
TkA01G323230	`PF04607`	RelA_SpoT	373	498	1.6e-28	100.0
TkA01G323230	`PF04607`	RelA_SpoT	506	535	1.6e-28	100.0
TkA01G323230	`PF23564`	EF-hand_FSTL1	532	563	0.064	14.4
TkA01G323230	`PF17959`	EF-hand_14	538	580	0.12	13.4
TkA01G323230	`PF13202`	EF-hand_5	539	562	5.8e-10	38.9
TkA01G323230	`PF00036`	EF-hand_1	541	564	8.7e-12	44.4
TkA01G323230	`PF13499`	EF-hand_7	541	592	5.8e-11	43.3
TkA01G323230	`PF13405`	EF-hand_6	541	566	1.2e-08	34.7
TkA01G323230	`PF13833`	EF-hand_8	541	562	0.0001	22.7
TkA01G323230	`PF29176`	Allatotropin-like_C	541	558	0.015	15.5
TkA01G323230	`PF24548`	EF_EFCAB10_C	541	572	0.038	14.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84R11`	Arabidopsis thaliana	sp\|Q84R11\|CRSH_ARATH Probable GTP diphosphokinase CRSH, chloroplastic	64.700%	Swiss-Prot	High
`Q6ATB4`	Oryza sativa subsp. japonica	sp\|Q6ATB4\|CRSH1_ORYSJ GTP diphosphokinase CRSH1, chloroplastic	59.200%	Swiss-Prot	High
`Q75IS2`	Oryza sativa subsp. japonica	sp\|Q75IS2\|CRSH3_ORYSJ GTP diphosphokinase CRSH3, chloroplastic	53.000%	Swiss-Prot	High
`Q6ATB2`	Oryza sativa subsp. japonica	sp\|Q6ATB2\|CRSH2_ORYSJ GTP diphosphokinase CRSH2, chloroplastic	52.200%	Swiss-Prot	High
`Q67UU0`	Oryza sativa subsp. japonica	sp\|Q67UU0\|RSH3_ORYSJ Probable GTP diphosphokinase RSH3, chloroplastic	33.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card