TkA01G087040 | RubberDandelionOmics

Gene overview

TkA01G087040

Reference: TK1151 Chr: Chr01 Coordinates: 22179266-22179664 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

399 bp · TkA01G087040|TK1151|cDNA

ATGGCTGAAGAACAGGAATGGCACAAAGCAAGCAATCACGTCCTCTGCGCGAATAACTGCGGCTTTTTTGGTAGCCCGACGACGCTCAACCTCTGTTCTAAATGCTACAAAGATCATCGCCTGGAAGAACAACATATGTCGAACGCCAAATTAGTCGTTGAAAAAAGCCTCACACCGTCGGAAGTCCCACAACTACCATCATCGGAAACGTCTGCTTCCACAAGCACGGCAGTCTCTCTTTCCGTCGCTACAGATCTAGA...

CDS

Download CDS FASTA

399 bp · TkA01G087040|TK1151|CDS

ATGGCTGAAGAACAGGAATGGCACAAAGCAAGCAATCACGTCCTCTGCGCGAATAACTGCGGCTTTTTTGGTAGCCCGACGACGCTCAACCTCTGTTCTAAATGCTACAAAGATCATCGCCTGGAAGAACAACATATGTCGAACGCCAAATTAGTCGTTGAAAAAAGCCTCACACCGTCGGAAGTCCCACAACTACCATCATCGGAAACGTCTGCTTCCACAAGCACGGCAGTCTCTCTTTCCGTCGCTACAGATCTAGA...

Protein

Download Protein FASTA

132 aa · TkA01G087040|TK1151|PROTEIN

MAEEQEWHKASNHVLCANNCGFFGSPTTLNLCSKCYKDHRLEEQHMSNAKLVVEKSLTPSEVPQLPSSETSASTSTAVSLSVATDLESGVVPASLSPAAVIMLLDLTVDIGGTGYVRESKKEREIKKEKRER

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G087040`
TK1151 ID	TkA01G087040
OH-1004 ID	LXL04_005005
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 86.364 / OH-1004 44.882 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G087040

Location Chr01:22179266-22179664 (+)

Description Similar to SAP4: Zinc finger A20 and AN1 domain-containing stress-associated protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36320`	May be involved in environmental stress response.	No verified direct reference in this release
`At1g12440`	May be involved in environmental stress response.	No verified direct reference in this release
`At2g27580`	May be involved in environmental stress response.	No verified direct reference in this release
`At4g12040`	May be involved in environmental stress response.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0530300`	May be involved in environmental stress response.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005005 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12440

ath:AT2G36320

ath:AT4G12040

ath:AT4G22820

dosa:Os02g0530300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.525

Rank 1 · TkA01G087040 · TK1151

Cytoplasm0.461

Rank 2 · TkA01G087040 · TK1151

Cell membrane0.073

Rank 3 · TkA01G087040 · TK1151

Mitochondrion0.045

Rank 4 · TkA01G087040 · TK1151

Golgi apparatus0.043

Rank 5 · TkA01G087040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01754zf-A2015-41 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G087040	`PF01754`	zf-A20	15	41	1.9e-15	56.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJM6`	Arabidopsis thaliana	sp\|Q9SJM6\|SAP4_ARATH Zinc finger A20 and AN1 domain-containing stress-associated protein 4	50.800%	Swiss-Prot	Low
`Q6NNI8`	Arabidopsis thaliana	sp\|Q6NNI8\|SAP1_ARATH Zinc finger A20 and AN1 domain-containing stress-associated protein 1	57.100%	Swiss-Prot	Low
`Q9ZNU9`	Arabidopsis thaliana	sp\|Q9ZNU9\|SAP3_ARATH Zinc finger A20 and AN1 domain-containing stress-associated protein 3	54.400%	Swiss-Prot	Low
`Q9SZ69`	Arabidopsis thaliana	sp\|Q9SZ69\|SAP7_ARATH Zinc finger A20 and AN1 domain-containing stress-associated protein 7	58.100%	Swiss-Prot	Low
`Q6H754`	Oryza sativa subsp. japonica	sp\|Q6H754\|SAP5_ORYSJ Zinc finger A20 and AN1 domain-containing stress-associated protein 5	62.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card