LXL04_036592 | RubberDandelionOmics

Gene overview

LXL04_036592

Reference: OH-1004 Chr: Chr08 Coordinates: 45046020-45046934 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

636 bp · LXL04_036592|LXL04_036592|OH1004|cDNA

ATGTGTTCTACGTACCAAAGAGCCAAGCCCGTTATAACTGATCCAGGGCTATACAGTCTCAAAAAATCCGACGTATTTTGGGTCTCCCAAAAAGGAGCGTACCTACAGCTTACAAGCTCTTCACGGTTCAGCTTGGATGATGCTTTCAAGACCCTTTATAGAATATTGTTTATGGGATGGGATAACTTTCCAAGAATTGTCCTCATGTATTATGCCAACTTTCTTTCATCTCCTAAAGGCTATTTCCACAATGTAATTTG...

CDS

Download CDS FASTA

636 bp · LXL04_036592|LXL04_036592|OH1004|CDS

ATGTGTTCTACGTACCAAAGAGCCAAGCCCGTTATAACTGATCCAGGGCTATACAGTCTCAAAAAATCCGACGTATTTTGGGTCTCCCAAAAAGGAGCGTACCTACAGCTTACAAGCTCTTCACGGTTCAGCTTGGATGATGCTTTCAAGACCCTTTATAGAATATTGTTTATGGGATGGGATAACTTTCCAAGAATTGTCCTCATGTATTATGCCAACTTTCTTTCATCTCCTAAAGGCTATTTCCACAATGTAATTTG...

Protein

Download Protein FASTA

211 aa · LXL04_036592|LXL04_036592|OH1004|PROTEIN

MCSTYQRAKPVITDPGLYSLKKSDVFWVSQKGAYLQLTSSSRFSLDDAFKTLYRILFMGWDNFPRIVLMYYANFLSSPKGYFHNVICNAEEFKNTTVNHDLHFIYNGGIEKIAWDATGERLVVAYKDGNELYKGLIATYDVKRATIITSSLIGFIRGPGEDPKPLTFSFHDKYKQDPLLSVRDGIGNVWMQVWITGSCVTYPLLIRLHLLA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036592`
TK1151 ID	TkA02G558220
OH-1004 ID	LXL04_036592
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	70.700
Protein coverage (%)	TK1151 83.150 / OH-1004 98.104 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036592

Location Chr08:45046020-45046934 (+)

Description Similar to AAAS: Aladin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56900`	Aladin.	No verified direct reference in this release
`At5g15050`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891
`At5g39990`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	A β-glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a role in cell elongation during seedling growth.2013 · DOI: 10.1111/tpj.12353
`At2g37585`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036592 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0015031 protein transport Biological Process

GO:0051028 mRNA transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015020 glucuronosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37585

ath:AT3G56900

ath:AT5G15050

ath:AT5G39990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.462

Rank 1 · LXL04_036592 · OH-1004

Nucleus0.394

Rank 2 · LXL04_036592 · OH-1004

Endoplasmic reticulum0.124

Rank 3 · LXL04_036592 · OH-1004

Cell membrane0.083

Rank 4 · LXL04_036592 · OH-1004

Golgi apparatus0.083

Rank 5 · LXL04_036592 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485.28Branch6-104 aa

PF25460.2Beta-prop_Aladin89-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036592	`PF02485.28`	Branch	6	104	6.2e-11	43.0
LXL04_036592	`PF25460.2`	Beta-prop_Aladin	89	185	1.3e-07	31.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWR1`	Arabidopsis thaliana	Aladin	63.107%	Swiss-Prot	weak database homology
`Q9LFQ0`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14B	63.107%	Swiss-Prot	weak database homology
`Q9FLD7`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14A	62.136%	Swiss-Prot	weak database homology
`Q8S8P3`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14C	42.857%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card