TkA02G558220 | RubberDandelionOmics

Gene overview

TkA02G558220

Reference: TK1151 Chr: Chr02 Coordinates: 144224693-144226476 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

944 bp · TkA02G558220|TK1151|cDNA

CAGGCCACCGGTGTTGATCCAGAAGCTTCGCATTCTCGAGATGATCCAGAATCTTTACTATATTTGCTTCACACATTGTCAACTGTGCCTAGGGACCTAAATTTCATCGAGCATACAAGTGACATTGGTTGGAAAGAGTACCAAAGAGCCAAGCCCGTTATAACTGATCCAGGGCTATACAGTCTCAAAAAATCCGACGTATTTTGGGTCTCCCAAAAAGGAGCGTTCAGCTTGGATGATGCTTTCAAGACCCTTTATAG...

CDS

Download CDS FASTA

822 bp · TkA02G558220|TK1151|CDS

CAGGCCACCGGTGTTGATCCAGAAGCTTCGCATTCTCGAGATGATCCAGAATCTTTACTATATTTGCTTCACACATTGTCAACTGTGCCTAGGGACCTAAATTTCATCGAGCATACAAGTGACATTGGTTGGAAAGAGTACCAAAGAGCCAAGCCCGTTATAACTGATCCAGGGCTATACAGTCTCAAAAAATCCGACGTATTTTGGGTCTCCCAAAAAGGAGCGTTCAGCTTGGATGATGCTTTCAAGACCCTTTATAG...

Protein

Download Protein FASTA

273 aa · TkA02G558220|TK1151|PROTEIN

QATGVDPEASHSRDDPESLLYLLHTLSTVPRDLNFIEHTSDIGWKEYQRAKPVITDPGLYSLKKSDVFWVSQKGAFSLDDAFKTLYRILFMGWDNFPRIVLMYYANFLSSPEGYFHNVICNAEEFKNTTEAAWDPNGRMILIAFSESLTLSSIHFATKPPLLDAHLLPVELPKLESLTKGIKKIAWDATGERLVVAYKDGNELYKGLIATYDVKRATIITFSLIGFIRGPREDPKPLTFSFHDKYKQDPLLSVVWITGSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G558220`
TK1151 ID	TkA02G558220
OH-1004 ID	LXL04_036592
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	70.700
Protein coverage (%)	TK1151 83.150 / OH-1004 98.104 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G558220

Location Chr02:144224693-144226476 (+)

Description Similar to AAAS: Aladin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56900`	Aladin.	No verified direct reference in this release
`At5g15050`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891
`At5g39990`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	A β-glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a role in cell elongation during seedling growth.2013 · DOI: 10.1111/tpj.12353
`At2g37585`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036592 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0015031 protein transport Biological Process

GO:0051028 mRNA transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015020 glucuronosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37585

ath:AT3G56900

ath:AT5G15050

ath:AT5G39990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.499

Rank 1 · TkA02G558220 · TK1151

Cytoplasm0.434

Rank 2 · TkA02G558220 · TK1151

Endoplasmic reticulum0.073

Rank 3 · TkA02G558220 · TK1151

Cell membrane0.064

Rank 4 · TkA02G558220 · TK1151

Golgi apparatus0.054

Rank 5 · TkA02G558220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485Branch21-129 aa

PF21544PorZ_N_b_propeller56-66 aa

PF24797Beta-prop_WDR35_TULP_N121-145 aa

PF12894ANAPC4_WD40126-147 aa

PF21544PorZ_N_b_propeller129-146 aa

PF25460Beta-prop_Aladin130-265 aa

PF12894ANAPC4_WD40178-201 aa

PF21544PorZ_N_b_propeller179-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G558220	`PF02485`	Branch	21	129	6.2e-16	59.4
TkA02G558220	`PF21544`	PorZ_N_b_propeller	56	66	0.16	12.9
TkA02G558220	`PF24797`	Beta-prop_WDR35_TULP_N	121	145	0.21	11.4
TkA02G558220	`PF12894`	ANAPC4_WD40	126	147	0.00026	21.9
TkA02G558220	`PF21544`	PorZ_N_b_propeller	129	146	0.16	12.9
TkA02G558220	`PF25460`	Beta-prop_Aladin	130	265	1.5e-11	44.7
TkA02G558220	`PF12894`	ANAPC4_WD40	178	201	0.00026	21.9
TkA02G558220	`PF21544`	PorZ_N_b_propeller	179	201	0.16	12.9
TkA02G558220	`PF24797`	Beta-prop_WDR35_TULP_N	181	201	0.21	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GWR1`	Arabidopsis thaliana	sp\|Q8GWR1\|AAAS_ARATH Aladin	66.900%	Swiss-Prot	Medium
`Q9LFQ0`	Arabidopsis thaliana	sp\|Q9LFQ0\|GT14B_ARATH Beta-glucuronosyltransferase GlcAT14B	65.800%	Swiss-Prot	Low
`Q9FLD7`	Arabidopsis thaliana	sp\|Q9FLD7\|GT14A_ARATH Beta-glucuronosyltransferase GlcAT14A	63.300%	Swiss-Prot	Low
`Q8S8P3`	Arabidopsis thaliana	sp\|Q8S8P3\|GT14C_ARATH Beta-glucuronosyltransferase GlcAT14C	49.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card