RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_033709
Reference: OH-1004 Chr: Chr07 Coordinates: 53942524-53963159 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

9939 bp · LXL04_033709|LXL04_033709|OH1004|cDNA

ATGGCGTACCCTCGAAGGGCATCTGAGCAGCAGCCACCTGGCAAGCTGCTGAGAACTCAAACAGCTGGCAATTTGGGAGGGGAGGCGATGATGGATAGTGAAGTAGTGCCTTCATCTCTTGTTACAATTGCACCTATTCTTCGTGTTGCTAATGAAGTTGAACCTACCAATCCAAGGGTTGCCTATCTCTGTCGATTCTATGCCTTTGAGCAAGCTCACAAACTAGATCCAACATCAAGTGGTCGTGGTGTTCGTCAATT...

CDS

Download CDS FASTA

9939 bp · LXL04_033709|LXL04_033709|OH1004|CDS

ATGGCGTACCCTCGAAGGGCATCTGAGCAGCAGCCACCTGGCAAGCTGCTGAGAACTCAAACAGCTGGCAATTTGGGAGGGGAGGCGATGATGGATAGTGAAGTAGTGCCTTCATCTCTTGTTACAATTGCACCTATTCTTCGTGTTGCTAATGAAGTTGAACCTACCAATCCAAGGGTTGCCTATCTCTGTCGATTCTATGCCTTTGAGCAAGCTCACAAACTAGATCCAACATCAAGTGGTCGTGGTGTTCGTCAATT...

Protein

Download Protein FASTA

3312 aa · LXL04_033709|LXL04_033709|OH1004|PROTEIN

MAYPRRASEQQPPGKLLRTQTAGNLGGEAMMDSEVVPSSLVTIAPILRVANEVEPTNPRVAYLCRFYAFEQAHKLDPTSSGRGVRQFKTALLQRLEREDATTLIGRKNSDAREMQSYYRHFYGKYIQALQNADKADRTRLTKAYQTAAVLFEVLKAVNLGESVDVAEEILEAHKKVADKTEMYAPYNILPLDPDSSNQAIMRLPEIQASVTALRNTRGLPWPKGYKKKPDEDILDWLQTMFGFQKDSVSNQREHLILLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_033709
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_033709
LocationChr07:53942524-53963159 (-)
DescriptionSimilar to CALS3: Callose synthase 3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g13000 Involved in callose synthesis at the forming cell plate during cytokinesis. No verified direct reference in this release
At2g31960 Involved in callose synthesis at the forming cell plate during cytokinesis. No verified direct reference in this release
At1g05570 Involved in callose synthesis at the forming cell plate during cytokinesis.
An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation.2003 · DOI: 10.1105/tpc.016097
At2g13680 Required for the formation of the callose wall separating the tetraspores (interstitial wall) and surrounding the pollen mother cells (peripheral wall).
Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02379.x
Callose (beta-1,3 glucan) is essential for Arabidopsis pollen wall patterning, but not tube growth.2005 · DOI: 10.1186/1471-2229-5-22
At5g36870 Involved in callose synthesis at the forming cell plate during cytokinesis. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_033709 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process
GO:0008360 regulation of cell shape Biological Process
GO:0071555 cell wall organization Biological Process
GO:0000148 1,3-beta-D-glucan synthase complex Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009504 cell plate Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0003843 1,3-beta-D-glucan synthase activity Molecular Function
GO:0046527 glucosyltransferase activity Molecular Function
KEGG gene cross-reference
ath:AT1G05570
ath:AT2G31960
ath:AT5G13000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.622
Rank 1 · LXL04_033709 · OH-1004
Endoplasmic reticulum0.199
Rank 2 · LXL04_033709 · OH-1004
Golgi apparatus0.117
Rank 3 · LXL04_033709 · OH-1004
Cytoplasm0.112
Rank 4 · LXL04_033709 · OH-1004
Lysosome / Vacuole0.089
Rank 5 · LXL04_033709 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04652.22Vta143-169 aa
PF14288.12FKS1_dom1318-430 aa
PF25968.1CALS1848-1035 aa
PF02364.22Glucan_synthase1043-1130 aa
PF02364.22Glucan_synthase1135-1752 aa
PF25968.1CALS12218-2405 aa
PF02364.22Glucan_synthase2413-2500 aa
PF02364.22Glucan_synthase2505-3122 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_033709PF04652.22Vta1431692.5e-1660.7
LXL04_033709PF14288.12FKS1_dom13184302e-42144.7
LXL04_033709PF25968.1CALS184810356.2e-126417.6
LXL04_033709PF02364.22Glucan_synthase104311301557.6
LXL04_033709PF02364.22Glucan_synthase113517521557.6
LXL04_033709PF25968.1CALS1221824056.2e-126417.6
LXL04_033709PF02364.22Glucan_synthase241325001557.6
LXL04_033709PF02364.22Glucan_synthase250531221557.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LXT9Arabidopsis thalianaCallose synthase 374.667%Swiss-Protmoderate database homology
Q9SL03Arabidopsis thalianaCallose synthase 274.116%Swiss-Protmoderate database homology
Q9AUE0Arabidopsis thalianaCallose synthase 173.606%Swiss-Protmoderate database homology
Q3B724Arabidopsis thalianaCallose synthase 558.802%Swiss-Protmoderate database homology
Q9LTG5Arabidopsis thalianaCallose synthase 460.812%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser