LXL04_025150 | RubberDandelionOmics

Gene overview

LXL04_025150

Reference: OH-1004 Chr: Chr05 Coordinates: 106794809-106796409 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1005 bp · LXL04_025150|LXL04_025150|OH1004|cDNA

ATGTTTCTTGGAGTGTCTTCTCTGTTCCTCCCCTCTTCTCCCATCCAAACTTCACACTCGTTCACTCCCTTCCATCAGCTCAACGTCAAATTGAATTTGTATCTTCGTAAATCTACCCCCAAATCGAGCCAAAACGTTACGAATTCGCCATCAACGTCATCCTGTGGCAGCAGCAGGAAGAATATTTGTTTATGTGGGAGACGgccatttttagcaacaattTCAACAGCTCTCATCCCAATTCGATATTCCAATGGTTT...

CDS

Download CDS FASTA

1005 bp · LXL04_025150|LXL04_025150|OH1004|CDS

ATGTTTCTTGGAGTGTCTTCTCTGTTCCTCCCCTCTTCTCCCATCCAAACTTCACACTCGTTCACTCCCTTCCATCAGCTCAACGTCAAATTGAATTTGTATCTTCGTAAATCTACCCCCAAATCGAGCCAAAACGTTACGAATTCGCCATCAACGTCATCCTGTGGCAGCAGCAGGAAGAATATTTGTTTATGTGGGAGACGGCCATTTTTAGCAACAATTTCAACAGCTCTCATCCCAATTCGATATTCCAATGGTTT...

Protein

Download Protein FASTA

334 aa · LXL04_025150|LXL04_025150|OH1004|PROTEIN

MFLGVSSLFLPSSPIQTSHSFTPFHQLNVKLNLYLRKSTPKSSQNVTNSPSTSSCGSSRKNICLCGRRPFLATISTALIPIRYSNGLDSLPDDPMVLNFDYIIEHIQWSMKAVLNRVHPPRPDWYEEFYAKAMDTTMKSYEAEIAGYKSQLFAKITGKATNILEIGIGTGPNLKYYATATSNTNIIGVDPNKKMEKYALAAAHASGLPQKNFKFIHAVAESLPVSDASMDAVVGTLVLCSVKDVHKTLQEIKRVLKPGGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025150`
TK1151 ID	TkA06G078460
OH-1004 ID	LXL04_025150
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_025150`
Location	Chr05:106794809-106796409 (+)
Description	Similar to Mettl7b: Methyltransferase-like protein 7B
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025150` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0032259 methylation Biological Process GO:0180035 lncRNA processing Biological Process GO:0005576 extracellular region Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005811 lipid droplet Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:1904724 tertiary granule lumen Cellular Component GO:0001734 mRNA m(6)A methyltransferase activity Molecular Function GO:0008168 methyltransferase activity Molecular Function GO:0008173 RNA methyltransferase activity Molecular Function
KEGG gene cross-reference	bsu:BSU03160 hsa:196410 hsa:25840 mmu:71664 rno:366792 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.968

Rank 1 · LXL04_025150 · OH-1004

Mitochondrion0.037

Rank 2 · LXL04_025150 · OH-1004

Cytoplasm0.015

Rank 3 · LXL04_025150 · OH-1004

Nucleus0.015

Rank 4 · LXL04_025150 · OH-1004

Cell membrane0.014

Rank 5 · LXL04_025150 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13489.13Methyltransf_23148-269 aa

PF13847.13Methyltransf_31158-268 aa

PF01209.25Ubie_methyltran158-266 aa

PF13649.13Methyltransf_25162-259 aa

PF08241.19Methyltransf_11163-263 aa

PF08242.19Methyltransf_12163-260 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025150	`PF13489.13`	Methyltransf_23	148	269	7.5e-14	52.5
LXL04_025150	`PF13847.13`	Methyltransf_31	158	268	1.4e-14	54.9
LXL04_025150	`PF01209.25`	Ubie_methyltran	158	266	3.2e-12	47.0
LXL04_025150	`PF13649.13`	Methyltransf_25	162	259	8.8e-19	68.7
LXL04_025150	`PF08241.19`	Methyltransf_11	163	263	3.2e-22	79.7
LXL04_025150	`PF08242.19`	Methyltransf_12	163	260	4e-14	53.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card