LXL04_023961 | RubberDandelionOmics

Gene overview

LXL04_023961

Reference: OH-1004 Chr: Chr05 Coordinates: 75724156-75728825 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2982 bp · LXL04_023961|LXL04_023961|OH1004|cDNA

ATGGCTTCGGTGGCGATAACCAGAAAAAATCAGCTCGTCTCTTCTCTACTCCATGGTTTCCGATGTCGAAGATCATATTTCCCTCGTACAATCACCACCAGCCGTCTCAGCTTTACGACGTCAACTTCCACTTCTCCGGCAGATACAGAAattcccgtatccagaaccaAAGTCCTTGAAACTTTTAAAGAAGAATTCGAAATTGGATCACGCCTGCTCACCTTAGAAACAGGGAAAATCGCGCGGTTCGCCAATGGGGC...

CDS

Download CDS FASTA

2982 bp · LXL04_023961|LXL04_023961|OH1004|CDS

ATGGCTTCGGTGGCGATAACCAGAAAAAATCAGCTCGTCTCTTCTCTACTCCATGGTTTCCGATGTCGAAGATCATATTTCCCTCGTACAATCACCACCAGCCGTCTCAGCTTTACGACGTCAACTTCCACTTCTCCGGCAGATACAGAAATTCCCGTATCCAGAACCAAAGTCCTTGAAACTTTTAAAGAAGAATTCGAAATTGGATCACGCCTGCTCACCTTAGAAACAGGGAAAATCGCGCGGTTCGCCAATGGGGC...

Protein

Download Protein FASTA

993 aa · LXL04_023961|LXL04_023961|OH1004|PROTEIN

MASVAITRKNQLVSSLLHGFRCRRSYFPRTITTSRLSFTTSTSTSPADTEIPVSRTKVLETFKEEFEIGSRLLTLETGKIARFANGAVVLGIDDTKVLSTVCSAKGDGVRDFLPLTVDYQEKQFAQGVIPGTYMRREGAPKERELLCGRLIDRPIRPLFPAGFYDEVQVMASVLSSDGKQDPDIMAANATSAALMLSDVPWGGPIGMIRIGRIDGHLVVNPTMDEVVIFFPLILILLTVRNCYIQIAINTLLSHCMQLNL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023961`
TK1151 ID	TkAUNG018460
OH-1004 ID	LXL04_023961
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	95.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023961

Location Chr05:75724156-75728825 (-)

Description Similar to PNP2: Polyribonucleotide nucleotidyltransferase 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g14580`	Involved in the 3'-end maturation of mitochondrial mRNAs, rRNAs and tRNAs.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0617700`	Involved in the 3'-end maturation of mitochondrial mRNAs, rRNAs and tRNAs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000957 mitochondrial RNA catabolic process Biological Process

GO:0000958 mitochondrial mRNA catabolic process Biological Process

GO:0000963 mitochondrial RNA processing Biological Process

GO:0000965 mitochondrial RNA 3'-end processing Biological Process

GO:0006364 rRNA processing Biological Process

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006402 mRNA catabolic process Biological Process

GO:0008033 tRNA processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT5G14580

dosa:Os02g0617700

gwc:GWCH70_1161

min:Minf_2124

tro:trd_0623

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.663

Rank 1 · LXL04_023961 · OH-1004

Plastid0.360

Rank 2 · LXL04_023961 · OH-1004

Cytoplasm0.052

Rank 3 · LXL04_023961 · OH-1004

Nucleus0.049

Rank 4 · LXL04_023961 · OH-1004

Peroxisome0.015

Rank 5 · LXL04_023961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01138.28RNase_PH71-200 aa

PF03725.21RNase_PH_C203-297 aa

PF03726.20PNPase331-410 aa

PF01138.28RNase_PH413-546 aa

PF00575.30S1717-787 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023961	`PF01138.28`	RNase_PH	71	200	2.5e-55	187.1
LXL04_023961	`PF03725.21`	RNase_PH_C	203	297	2.8e-10	40.7
LXL04_023961	`PF03726.20`	PNPase	331	410	7.8e-14	52.6
LXL04_023961	`PF01138.28`	RNase_PH	413	546	2.5e-55	187.1
LXL04_023961	`PF00575.30`	S1	717	787	5.1e-15	56.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7G6`	Arabidopsis thaliana	Polyribonucleotide nucleotidyltransferase 2, mitochondrial	61.278%	Swiss-Prot	strong database homology
`Q6KAI0`	Oryza sativa subsp. japonica	Polyribonucleotide nucleotidyltransferase 2, mitochondrial	61.934%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card