RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_023773
Reference: OH-1004 Chr: Chr05 Coordinates: 67932795-67938993 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2526 bp · LXL04_023773|LXL04_023773|OH1004|cDNA

ATGCACATACACATGAGACATTCCACAAGCGAATTAGCGAATCGGATAAGCAGAGCGCTGATCGCCGCCTCTCATCAGTCCGACCCGCCGCGGACATGGACTCCGGTACTCGAACAAACCCTCCATGGAATCGGTTGCCGCCACTCCCTCAACCCAACACTCGTTTCCCGAGTGATCGACCCTTTCCTCATCCACCACCATTCACTCGCACTCGGCTTCTTCAACTGGGCCTCTCAGCAACCAGGATTCACCCACTCTTC...

CDS

Download CDS FASTA

2526 bp · LXL04_023773|LXL04_023773|OH1004|CDS

ATGCACATACACATGAGACATTCCACAAGCGAATTAGCGAATCGGATAAGCAGAGCGCTGATCGCCGCCTCTCATCAGTCCGACCCGCCGCGGACATGGACTCCGGTACTCGAACAAACCCTCCATGGAATCGGTTGCCGCCACTCCCTCAACCCAACACTCGTTTCCCGAGTGATCGACCCTTTCCTCATCCACCACCATTCACTCGCACTCGGCTTCTTCAACTGGGCCTCTCAGCAACCAGGATTCACCCACTCTTC...

Protein

Download Protein FASTA

841 aa · LXL04_023773|LXL04_023773|OH1004|PROTEIN

MHIHMRHSTSELANRISRALIAASHQSDPPRTWTPVLEQTLHGIGCRHSLNPTLVSRVIDPFLIHHHSLALGFFNWASQQPGFTHSSISYQSILKSLSISRQSAAVDTLMKQVKTSKIQLNPSLYRSIIASHIAAKRSLNAFSVFNDVRFLVPDIGPDTCNSLVAALSSAGNLGYTHQVFDQMTTRHIRLSTLGIGVFLWKFSRTAELDKTLSFLDDVKTQNPDINGSILALLILHGLSSENRVHEAMYMLDLLRKKDCK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_023773
TK1151 IDTkA06G221140
OH-1004 IDLXL04_023773
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)93.900
Protein coverage (%)TK1151 100.000 / OH-1004 99.524
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_023773
LocationChr05:67932795-67938993 (-)
DescriptionSimilar to At5g14080: Pentatricopeptide repeat-containing protein At5g14080
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g14080 Pentatricopeptide repeat-containing protein At5g14080. No verified direct reference in this release
At5g64320 Pentatricopeptide repeat-containing protein At5g64320, mitochondrial. No verified direct reference in this release
At3g53700 May be involved in female gametophyte development. No verified direct reference in this release
At5g65560 Pentatricopeptide repeat-containing protein At5g65560. No verified direct reference in this release
At5g16420 Pentatricopeptide repeat-containing protein At5g16420, mitochondrial. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_023773 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006397 mRNA processing Biological Process
GO:0032543 mitochondrial translation Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0003729 mRNA binding Molecular Function
KEGG gene cross-reference
ath:AT5G14080
ath:AT5G64320
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.520
Rank 1 · LXL04_023773 · OH-1004
Plastid0.184
Rank 2 · LXL04_023773 · OH-1004
Nucleus0.164
Rank 3 · LXL04_023773 · OH-1004
Cytoplasm0.088
Rank 4 · LXL04_023773 · OH-1004
Cell membrane0.019
Rank 5 · LXL04_023773 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17177.11PPR_long388-515 aa
PF13812.13PPR_3398-447 aa
PF13041.13PPR_2404-437 aa
PF01535.27PPR405-433 aa
PF12854.14PPR_1405-429 aa
PF29070.1MSC6_N414-531 aa
PF13812.13PPR_3424-480 aa
PF13041.13PPR_2435-482 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_023773PF17177.11PPR_long3885151.1e-0938.7
LXL04_023773PF13812.13PPR_33984478.9e-2380.9
LXL04_023773PF13041.13PPR_24044372.2e-44150.0
LXL04_023773PF01535.27PPR4054336.5e-2998.8
LXL04_023773PF12854.14PPR_14054299.1e-2999.6
LXL04_023773PF29070.1MSC6_N4145312.8e-0937.3
LXL04_023773PF13812.13PPR_34244808.9e-2380.9
LXL04_023773PF13041.13PPR_24354822.2e-44150.0
LXL04_023773PF12854.14PPR_14664989.1e-2999.6
LXL04_023773PF13041.13PPR_24705192.2e-44150.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FMU2Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g1408049.137%Swiss-Protmoderate database homology
Q9FMF6Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g64320, mitochondrial25.368%Swiss-Protweak database homology
Q9LFF1Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g53700, chloroplastic23.792%Swiss-Protweak database homology
Q9LSL9Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g6556021.997%Swiss-Protweak database homology
Q9FFE3Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g16420, mitochondrial24.532%Swiss-Protweak database homology

JBrowse

View in Genome Browser