LXL04_009171 | RubberDandelionOmics

Gene overview

LXL04_009171

Reference: OH-1004 Chr: Chr02 Coordinates: 119518549-119520747 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1488 bp · LXL04_009171|LXL04_009171|OH1004|cDNA

ATGGTGTTGGCGGAACTAGGGGGGAGCATTTCACGTGCTCTCCAGCAGATGAGCAATGCCACGATCATCGATGAGAAGGTTCTTAACGATTGCTTAAATGAAATCACTCGCGCTCTTCTCCAGTCCGATGTTCAATTCAAGCTCGTTCGTGAAATGCAAACTAATATTAAGAAGATCGTCAATCTCGATGATCTCGCTGCAGGCCATAACAAGCGAAAAATCATCCAACAGGCTATATTCAACGAGCTCTGCAAGATGTT...

CDS

Download CDS FASTA

1488 bp · LXL04_009171|LXL04_009171|OH1004|CDS

ATGGTGTTGGCGGAACTAGGGGGGAGCATTTCACGTGCTCTCCAGCAGATGAGCAATGCCACGATCATCGATGAGAAGGTTCTTAACGATTGCTTAAATGAAATCACTCGCGCTCTTCTCCAGTCCGATGTTCAATTCAAGCTCGTTCGTGAAATGCAAACTAATATTAAGAAGATCGTCAATCTCGATGATCTCGCTGCAGGCCATAACAAGCGAAAAATCATCCAACAGGCTATATTCAACGAGCTCTGCAAGATGTT...

Protein

Download Protein FASTA

495 aa · LXL04_009171|LXL04_009171|OH1004|PROTEIN

MVLAELGGSISRALQQMSNATIIDEKVLNDCLNEITRALLQSDVQFKLVREMQTNIKKIVNLDDLAAGHNKRKIIQQAIFNELCKMLDPGKPSFTPKKSKPSVVMFVGLQGSGKTTTCTKYAFYHQKKGWKPALVCADTFRAGAFDQLKQNATKAKIPFYGSYMESDPVKIAVEGVERFKKENCDLIIVDTSGRHKQEVALFEEMRQVSEATKPDLVIFVMDSSIGQAAFDQAQAFKQSVAVGAVIVTKMDGHAKGGGAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009171`
TK1151 ID	TkA03G405150
OH-1004 ID	LXL04_009171
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009171

Location Chr02:119518549-119520747 (+)

Description Similar to Signal recognition particle 54 kDa protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48900`	Component of the signal recognition particle (SRP) complex, a ribonucleoprotein complex that mediates the cotranslational targeting of secretory and membrane proteins to the endoplasmic reticulum (ER).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009171 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006616 SRP-dependent cotranslational protein targeting to membrane, translocation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005786 signal recognition particle, endoplasmic reticulum targeting Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0008312 7S RNA binding Molecular Function

GO:0030942 endoplasmic reticulum signal peptide binding Molecular Function

KEGG gene cross-reference

ath:AT1G48900

sly:544156

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.382

Rank 1 · LXL04_009171 · OH-1004

Mitochondrion0.331

Rank 2 · LXL04_009171 · OH-1004

Endoplasmic reticulum0.173

Rank 3 · LXL04_009171 · OH-1004

Nucleus0.120

Rank 4 · LXL04_009171 · OH-1004

Peroxisome0.100

Rank 5 · LXL04_009171 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02881.25SRP54_N6-83 aa

PF00448.29SRP54101-296 aa

PF02492.26cobW103-253 aa

PF02978.27SRP_SPB312-442 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009171	`PF02881.25`	SRP54_N	6	83	5.1e-14	52.9
LXL04_009171	`PF00448.29`	SRP54	101	296	5e-78	262.0
LXL04_009171	`PF02492.26`	cobW	103	253	1.7e-06	28.5
LXL04_009171	`PF02978.27`	SRP_SPB	312	442	7.1e-38	130.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49967`	Arabidopsis thaliana	Signal recognition particle subunit SRP54 3	88.889%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card