LXL04_006793 | RubberDandelionOmics

Gene overview

LXL04_006793

Reference: OH-1004 Chr: Chr02 Coordinates: 25249106-25251414 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1266 bp · LXL04_006793|LXL04_006793|OH1004|cDNA

ATGGCAGCCAAGGCAATGTATCTTTCCGTCACTAATCAGTCCTTATTCTCAACTCCTGCAACTATAAAACCACTACAAGTTAGATCATTCACTGTGAGATGCTCCACGGGTGCTACAGCTACTGCTCCTTGGAAGCTTGCAGATGCTAGACTTGTGCTTGAAGATGGATCCATTTGGAAAGCCAAATCATTTGGTGCTTCTGGGACTCAAGTTGGTGAAGTTGTATTTAACACTTCATTAACAGGGTACCAAGAAATTCT...

CDS

Download CDS FASTA

1266 bp · LXL04_006793|LXL04_006793|OH1004|CDS

ATGGCAGCCAAGGCAATGTATCTTTCCGTCACTAATCAGTCCTTATTCTCAACTCCTGCAACTATAAAACCACTACAAGTTAGATCATTCACTGTGAGATGCTCCACGGGTGCTACAGCTACTGCTCCTTGGAAGCTTGCAGATGCTAGACTTGTGCTTGAAGATGGATCCATTTGGAAAGCCAAATCATTTGGTGCTTCTGGGACTCAAGTTGGTGAAGTTGTATTTAACACTTCATTAACAGGGTACCAAGAAATTCT...

Protein

Download Protein FASTA

421 aa · LXL04_006793|LXL04_006793|OH1004|PROTEIN

MAAKAMYLSVTNQSLFSTPATIKPLQVRSFTVRCSTGATATAPWKLADARLVLEDGSIWKAKSFGASGTQVGEVVFNTSLTGYQEILTDPSYAGQFVLMTNPHIGNTGVNIDDEESVKCFLAGLVIRSLSISTSNWRCTESLSDYLSKRNIMGIYDVDTRAITRRLREDGSLIGVLSTEKSKTDEELLEMSRNWDIVGVDLISSVSCKKPYEWAGKTDMEWDFNSNRRNSESFHVVAYDFGIKHNILRRLASYGCKITVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006793`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006793

Location Chr02:25249106-25251414 (+)

Description Similar to CARA: Carbamoyl-phosphate synthase small chain, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27740`	Small subunit of the arginine-specific carbamoyl phosphate synthase (CPSase).	Analysis of ven3 and ven6 reticulate mutants reveals the importance of arginine biosynthesis in Arabidopsis leaf development.2011 · DOI: 10.1111/j.1365-313x.2010.04425.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0708100`	Small subunit of the arginine-specific carbamoyl phosphate synthase (CPSase).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006793 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006207 'de novo' pyrimidine nucleobase biosynthetic process Biological Process

GO:0006526 L-arginine biosynthetic process Biological Process

GO:0006541 glutamine metabolic process Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0044205 'de novo' UMP biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005951 carbamoyl-phosphate synthase complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004088 carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity Molecular Function

GO:0004359 glutaminase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ana:alr1155

ath:AT3G27740

dosa:Os02g0708100

syc:syc1970_d

syn:sll1498

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.953

Rank 1 · LXL04_006793 · OH-1004

Mitochondrion0.071

Rank 2 · LXL04_006793 · OH-1004

Cytoplasm0.029

Rank 3 · LXL04_006793 · OH-1004

Nucleus0.022

Rank 4 · LXL04_006793 · OH-1004

Cell membrane0.015

Rank 5 · LXL04_006793 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00988.29CPSase_sm_chain51-175 aa

PF00117.35GATase237-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006793	`PF00988.29`	CPSase_sm_chain	51	175	9.6e-50	168.3
LXL04_006793	`PF00117.35`	GATase	237	411	4.4e-54	183.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVW7`	Arabidopsis thaliana	Carbamoyl phosphate synthase small chain, chloroplastic	76.559%	Swiss-Prot	strong database homology
`Q6YV23`	Oryza sativa subsp. japonica	Carbamoyl phosphate synthase small chain, chloroplastic	80.319%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card