LXL04_005843 | RubberDandelionOmics

Gene overview

LXL04_005843

Reference: OH-1004 Chr: Chr01 Coordinates: 174410470-174424237 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

9090 bp · LXL04_005843|LXL04_005843|OH1004|cDNA

ATGGGTCGGATTTCGATTTTGATTTACACTATCTTCTATGTTTCAATAGCAAATTCTATTCAGCTTGATAATACCAAAACCTTCATAGTCAGGATTCAAAACGACTTGAAACCATCTGTTTTCACCGATGTAGAACATTGGTATAAGGCAACTCTTGGAAGCTTGAATTCAAGAAAGTCGGATTACAACAAATTCAACACCATCGAAGATAACCAAGACTTTCTTCATGTCTACAAGACTGTTTTCCATGGCTTTTCAAC...

CDS

Download CDS FASTA

9090 bp · LXL04_005843|LXL04_005843|OH1004|CDS

ATGGGTCGGATTTCGATTTTGATTTACACTATCTTCTATGTTTCAATAGCAAATTCTATTCAGCTTGATAATACCAAAACCTTCATAGTCAGGATTCAAAACGACTTGAAACCATCTGTTTTCACCGATGTAGAACATTGGTATAAGGCAACTCTTGGAAGCTTGAATTCAAGAAAGTCGGATTACAACAAATTCAACACCATCGAAGATAACCAAGACTTTCTTCATGTCTACAAGACTGTTTTCCATGGCTTTTCAAC...

Protein

Download Protein FASTA

3029 aa · LXL04_005843|LXL04_005843|OH1004|PROTEIN

MGRISILIYTIFYVSIANSIQLDNTKTFIVRIQNDLKPSVFTDVEHWYKATLGSLNSRKSDYNKFNTIEDNQDFLHVYKTVFHGFSTRLSPQEAQELETHPSVMAVLPDETLKLHTTRSIQFLGLDSNEPNTLLKESDYGSNAIIGILDTGISPESSSFHDQDLGPIPSDWKGECMEGEHFTKNLCNKKIIGARYFTAGYDASIGETNGSTQIKSSRDTDGHGTHTASTAAGRVVSNASLFGYAQGVAVGVAPKARIAVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005843`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_005843`
Location	Chr01:174410470-174424237 (-)
Description	Similar to SBT: Subtilisin-like protease
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005843` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0009609 response to symbiotic bacterium Biological Process GO:0009610 response to symbiotic fungus Biological Process GO:0036377 arbuscular mycorrhizal association Biological Process GO:0005615 extracellular space Cellular Component GO:0048046 apoplast Cellular Component GO:0004252 serine-type endopeptidase activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.244

Rank 1 · LXL04_005843 · OH-1004

Extracellular0.205

Rank 2 · LXL04_005843 · OH-1004

Endoplasmic reticulum0.190

Rank 3 · LXL04_005843 · OH-1004

Cytoplasm0.177

Rank 4 · LXL04_005843 · OH-1004

Cell membrane0.110

Rank 5 · LXL04_005843 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922.22Inhibitor_I927-115 aa

PF00082.28Peptidase_S8140-594 aa

PF02225.28PA392-473 aa

PF17766.8fn3_6673-763 aa

PF14244.13Retrotran_gag_3755-786 aa

PF14223.15Retrotran_gag_2765-939 aa

PF22936.2Pol_BBD1227-1300 aa

PF13976.12gag_pre-integrs1332-1397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005843	`PF05922.22`	Inhibitor_I9	27	115	3.1e-28	99.0
LXL04_005843	`PF00082.28`	Peptidase_S8	140	594	4.4e-96	322.3
LXL04_005843	`PF02225.28`	PA	392	473	7.3e-23	81.2
LXL04_005843	`PF17766.8`	fn3_6	673	763	1.5e-40	138.1
LXL04_005843	`PF14244.13`	Retrotran_gag_3	755	786	5.8e-12	45.9
LXL04_005843	`PF14223.15`	Retrotran_gag_2	765	939	1.4e-11	45.1
LXL04_005843	`PF22936.2`	Pol_BBD	1227	1300	5.9e-20	72.1
LXL04_005843	`PF13976.12`	gag_pre-integrs	1332	1397	5.5e-13	49.2
LXL04_005843	`PF00665.33`	rve	1411	1508	7.3e-10	39.7
LXL04_005843	`PF25597.2`	SH3_retrovirus	1582	1644	1.8e-19	70.0
LXL04_005843	`PF07727.20`	RVT_2	1795	1886	1.3e-36	127.2
LXL04_005843	`PF07727.20`	RVT_2	1911	1979	1.3e-36	127.2
LXL04_005843	`PF05922.22`	Inhibitor_I9	2238	2319	3.1e-28	99.0
LXL04_005843	`PF00082.28`	Peptidase_S8	2342	2770	4.4e-96	322.3
LXL04_005843	`PF02225.28`	PA	2563	2649	7.3e-23	81.2
LXL04_005843	`PF17766.8`	fn3_6	2843	2933	1.5e-40	138.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card