LXL04_005769 | RubberDandelionOmics

Gene overview

LXL04_005769

Reference: OH-1004 Chr: Chr01 Coordinates: 173141338-173142164 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

743 bp · LXL04_005769|LXL04_005769|OH1004|cDNA

ATGGAGAGTGCTTGTGTTTTTGAACAGACGAAAGTCATCCATGAGCTAAATCAAGGAATAAAAATGGCGGAACAACTTAGGCTTAACCTAAATTCACATGAAGCTAGAGAATTCCTGATAAAGAACATCTTATCTTCATATGAAAAAGCTCTTTTTGTTCTTAAATCCGGCGGGCAGCTTCGGCCAAGTCCACAACCTGAATCCAGTCTGCCGAATTCATCAACATCAACAGGCAGCCTGCAAAGCAAAGAGTTCGGGTT...

CDS

Download CDS FASTA

738 bp · LXL04_005769|LXL04_005769|OH1004|CDS

ATGGAGAGTGCTTGTGTTTTTGAACAGACGAAAGTCATCCATGAGCTAAATCAAGGAATAAAAATGGCGGAACAACTTAGGCTTAACCTAAATTCACATGAAGCTAGAGAATTCCTGATAAAGAACATCTTATCTTCATATGAAAAAGCTCTTTTTGTTCTTAAATCCGGCGGGCAGCTTCGGCCAAGTCCACAACCTGAATCCAGTCTGCCGAATTCATCAACATCAACAGGCAGCCTGCAAAGCAAAGAGTTCGGGTT...

Protein

Download Protein FASTA

245 aa · LXL04_005769|LXL04_005769|OH1004|PROTEIN

MESACVFEQTKVIHELNQGIKMAEQLRLNLNSHEAREFLIKNILSSYEKALFVLKSGGQLRPSPQPESSLPNSSTSTGSLQSKEFGFDENVFSKKRKASSPPHSPVFEITYKRIHTCNNVAQSPPPPPSPEKQKTKPTNHHHHELLSANPGEILSNMRANLTVNTWGLDDILPSSFSSPSTPFGFTDDDFESLNFPNYSDDELFQGYSPPFISPATSESNYLTDFWGNSSTMDFPTESAYLYPDF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005769`
TK1151 ID	TkA01G017440
OH-1004 ID	LXL04_005769
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005769

Location Chr01:173141338-173142164 (+)

Description Similar to WRKY53: Probable WRKY transcription factor 53

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23810`	Transcription factor.	The antagonist function of Arabidopsis WRKY53 and ESR/ESP in leaf senescence is modulated by the jasmonic and salicylic acid equilibrium.2007 · DOI: 10.1105/tpc.106.042705 A HECT E3 ubiquitin ligase negatively regulates Arabidopsis leaf senescence through degradation of the transcription factor WRKY53.2010 · DOI: 10.1111/j.1365-313x.2010.04233.x Arabidopsis WRKY46 coordinates with WRKY70 and WRKY53 in basal resistance against pathogen Pseudomonas syringae.2012 · DOI: 10.1016/j.plantsci.2011.12.003

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005769 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010193 response to ozone Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT4G23810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.931

Rank 1 · LXL04_005769 · OH-1004

Cytoplasm0.229

Rank 2 · LXL04_005769 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_005769 · OH-1004

Mitochondrion0.019

Rank 4 · LXL04_005769 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_005769 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUP6`	Arabidopsis thaliana	Probable WRKY transcription factor 53	37.113%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card