LXL04_005725 | RubberDandelionOmics

Gene overview

LXL04_005725

Reference: OH-1004 Chr: Chr01 Coordinates: 172215822-172224478 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3129 bp · LXL04_005725|LXL04_005725|OH1004|cDNA

CAATGTCTATCTACATGAGTTCTTGAAACTGTCATCTAAGATTGTGAAGCCTATCCAGGAACAGGAAGCATGGCAGCCACACCCAATCCCACACTGATTTATTCTCCAAAATCCTCGATTCACCTCACGAAAATTCAATTTTACGTTCGCTCCAACCCCTTCAGATCGTCTTCATCATCGAGGTCTGGTTCATTCGCGGTCAAATGCAGTAGCCCCGTCCCGAACAATTCTAGCTCCGAGCAGAACAACAATGGCGGGGG...

CDS

Download CDS FASTA

3060 bp · LXL04_005725|LXL04_005725|OH1004|CDS

ATGGCAGCCACACCCAATCCCACACTGATTTATTCTCCAAAATCCTCGATTCACCTCACGAAAATTCAATTTTACGTTCGCTCCAACCCCTTCAGATCGTCTTCATCATCGAGGTCTGGTTCATTCGCGGTCAAATGCAGTAGCCCCGTCCCGAACAATTCTAGCTCCGAGCAGAACAACAATGGCGGGGGATTGAAGAATCTGCTGTCCGGTATAGTCGACGAACGGGTAGACCAGTTGTTGAACAGCGACGAAAACAG...

Protein

Download Protein FASTA

1019 aa · LXL04_005725|LXL04_005725|OH1004|PROTEIN

MAATPNPTLIYSPKSSIHLTKIQFYVRSNPFRSSSSSRSGSFAVKCSSPVPNNSSSEQNNNGGGLKNLLSGIVDERVDQLLNSDENRALLDGLDKATQRVELAKRELAEIEKQEIENRKIKEYINQLESRASEIEECQKELSEARALVEEAERSLVGDTDTMMTETEREAMLKNKERFESVKAASISAIVGTIASLPISIAQASDTSQLILPSAIILISCALFGVTFRYAVRRDLDNFQLKTGTSAAFGFVKGLATLAGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005725`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005725

Location Chr01:172215822-172224478 (-)

Description Similar to YSL3: Metal-nicotianamine transporter YSL3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53550`	May be involved in the lateral transport of nicotianamine- chelated metals in the vasculature.	Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds.2006 · DOI: 10.1104/pp.106.082586
`At5g24380`	May be involved in the lateral transport of nicotianamine- chelated metals in the vasculature.	Arabidopsis Yellow Stripe-Like2 (YSL2): a metal-regulated gene encoding a plasma membrane transporter of nicotianamine-metal complexes.2004 · DOI: 10.1111/j.1365-313x.2004.02128.x
`At4g24120`	Involved in iron loading of the seeds.	A loss-of-function mutation in AtYSL1 reveals its role in iron and nicotianamine seed loading.2005 · DOI: 10.1111/j.1365-313x.2005.02569.x Mutations in Arabidopsis yellow stripe-like1 and yellow stripe-like3 reveal their roles in metal ion homeostasis and loading of metal ions in seeds.2006 · DOI: 10.1104/pp.106.082586

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0542200`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release
`Os04g0542800`	May be involved in the transport of nicotianamine-chelated metals.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005725 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0006811 monoatomic ion transport Biological Process

GO:0006826 iron ion transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0010039 response to iron ion Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0048316 seed development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0035673 oligopeptide transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT4G24120

ath:AT5G24380

ath:AT5G53550

dosa:Os04g0542200

dosa:Os04g0542800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.731

Rank 1 · LXL04_005725 · OH-1004

Endoplasmic reticulum0.110

Rank 2 · LXL04_005725 · OH-1004

Cell membrane0.075

Rank 3 · LXL04_005725 · OH-1004

Lysosome / Vacuole0.053

Rank 4 · LXL04_005725 · OH-1004

Golgi apparatus0.050

Rank 5 · LXL04_005725 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03169.21OPT321-876 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005725	`PF03169.21`	OPT	321	876	1.2e-124	418.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2EF88`	Arabidopsis thaliana	Metal-nicotianamine transporter YSL3	58.710%	Swiss-Prot	moderate database homology
`Q6R3K9`	Arabidopsis thaliana	Metal-nicotianamine transporter YSL2	57.464%	Swiss-Prot	moderate database homology
`Q6R3L0`	Arabidopsis thaliana	Metal-nicotianamine transporter YSL1	56.349%	Swiss-Prot	moderate database homology
`Q7XUJ2`	Oryza sativa subsp. japonica	Probable metal-nicotianamine transporter YSL9	55.089%	Swiss-Prot	moderate database homology
`Q7XN54`	Oryza sativa subsp. japonica	Probable metal-nicotianamine transporter YSL16	56.427%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card