LXL04_005580 | RubberDandelionOmics

Gene overview

LXL04_005580

Reference: OH-1004 Chr: Chr01 Coordinates: 168660723-168663302 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1105 bp · LXL04_005580|LXL04_005580|OH1004|cDNA

ATGGCGTATGCAGCATTGATGCCAACAAAAGTAGGGTTACAAGGCTCTACAGCTTTTGTTCATGGAGTCAACTCTGAGAGACTGAAAGTCAAAGTATCGGTCAAAATGCCAACCAAGGCTCTCAACATTAAATCTGCCTTGTCCTGTGTTGAAGAGAAGACAGGGTACAAGAACTTTTTACACATCGATGATTTCGACAAGGCAACACTGCTAAAGATTCTAGACCGGGCCCAAGAAGTAAAAGCCCTACTAAAGTCAGG...

CDS

Download CDS FASTA

1080 bp · LXL04_005580|LXL04_005580|OH1004|CDS

ATGGCGTATGCAGCATTGATGCCAACAAAAGTAGGGTTACAAGGCTCTACAGCTTTTGTTCATGGAGTCAACTCTGAGAGACTGAAAGTCAAAGTATCGGTCAAAATGCCAACCAAGGCTCTCAACATTAAATCTGCCTTGTCCTGTGTTGAAGAGAAGACAGGGTACAAGAACTTTTTACACATCGATGATTTCGACAAGGCAACACTGCTAAAGATTCTAGACCGGGCCCAAGAAGTAAAAGCCCTACTAAAGTCAGG...

Protein

Download Protein FASTA

359 aa · LXL04_005580|LXL04_005580|OH1004|PROTEIN

MAYAALMPTKVGLQGSTAFVHGVNSERLKVKVSVKMPTKALNIKSALSCVEEKTGYKNFLHIDDFDKATLLKILDRAQEVKALLKSGERTYLPFKGKTMAMIFAKPSMRTRVSFETGFHLLGGHAIYLGPKDIEMGKREETRDVARVLSRYNDIIMARLFAHQDLLDLANYANVPVINGLTDYNHPCQIMADALTMIEHVGGIEGTKVVYVGDGNNIVHSWLLLAAVVPFHFVCACPVGFEPDKETVEKAQRAGVGKIEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005580`
TK1151 ID	TkA01G032770
OH-1004 ID	LXL04_005580
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 96.730 / OH-1004 98.886 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005580

Location Chr01:168660723-168663302 (+)

Description Similar to ARGF: Ornithine carbamoyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75330`	Ornithine transcarbamylase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005580 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019240 citrulline biosynthetic process Biological Process

GO:0042450 L-arginine biosynthetic process via ornithine Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004585 ornithine carbamoyltransferase activity Molecular Function

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G75330

pab:PAB1502

pfu:PF0594

tko:TK0871

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.595

Rank 1 · LXL04_005580 · OH-1004

Nucleus0.225

Rank 2 · LXL04_005580 · OH-1004

Plastid0.137

Rank 3 · LXL04_005580 · OH-1004

Mitochondrion0.122

Rank 4 · LXL04_005580 · OH-1004

Peroxisome0.078

Rank 5 · LXL04_005580 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02729.27OTCace_N57-198 aa

PF00185.31OTCace204-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005580	`PF02729.27`	OTCace_N	57	198	8.2e-47	159.7
LXL04_005580	`PF00185.31`	OTCace	204	354	9.8e-58	195.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O50039`	Arabidopsis thaliana	Ornithine transcarbamylase, chloroplastic	81.935%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card