TkA01G032770 | RubberDandelionOmics

Gene overview

TkA01G032770

Reference: TK1151 Chr: Chr01 Coordinates: 8490531-8494028 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1467 bp · TkA01G032770|TK1151|cDNA

CTAATTTTGTCTCTATCAATAAAAACCCTCCTGCTTCTTTCCACCTCAACCACTGCCCACTTCCACCACTTCCAAGTTCCGGCAGATTATCGATCATTTGAAACACATTCCAAATTTCTCCCGCATTGTAATCAGGGATTTTGATATTTGACTTTGAAAGCAGGTGAATTTCAAAAGATGGCGTATGCAGCATTGATGCCAACAAAAGTAGGGTTACAAGGCTCTACAGCTTTTGTTCATGGAGTCAACTCTGAGAGACT...

CDS

Download CDS FASTA

1104 bp · TkA01G032770|TK1151|CDS

ATGGCGTATGCAGCATTGATGCCAACAAAAGTAGGGTTACAAGGCTCTACAGCTTTTGTTCATGGAGTCAACTCTGAGAGACTGAAAGTCAAAGGACCGGTCCAAATGCCAACCAAGGCTCTCAACATTAAATCTGCATTGTCATGTGTTGAAGAAAAGACAGGGTACAAGAACTTTTTACACATCGACGATTTCGACAAGGCAACACTGCTAAAGATTCTAGATCGCGCCCAAGAGGTAAAAGCCCTGCTAAAATCAGG...

Protein

Download Protein FASTA

367 aa · TkA01G032770|TK1151|PROTEIN

MAYAALMPTKVGLQGSTAFVHGVNSERLKVKGPVQMPTKALNIKSALSCVEEKTGYKNFLHIDDFDKATLLKILDRAQEVKALLKSGERTFLPFKGKTMAMIFAKPSMRTRVSFETGFHLLGGHAIYLGPKDIEMGKREETRDVARVLSRYNDIIMARLFAHQDLLDLANYASVPVINGLTDYNHPCQIMADALTMIEHVGGIEGTKVVYVGDGNNIVHSWLLLAAVVPFHFVCACPVGFEPDKETVEKAQRAGVGKIEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G032770`
TK1151 ID	TkA01G032770
OH-1004 ID	LXL04_005580
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 96.730 / OH-1004 98.886 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G032770

Location Chr01:8490531-8494028 (-)

Description Similar to ARGF: Ornithine carbamoyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75330`	Ornithine transcarbamylase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005580 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0019240 citrulline biosynthetic process Biological Process

GO:0042450 L-arginine biosynthetic process via ornithine Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004585 ornithine carbamoyltransferase activity Molecular Function

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G75330

pab:PAB1502

pfu:PF0594

tko:TK0871

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.575

Rank 1 · TkA01G032770 · TK1151

Nucleus0.228

Rank 2 · TkA01G032770 · TK1151

Mitochondrion0.153

Rank 3 · TkA01G032770 · TK1151

Plastid0.127

Rank 4 · TkA01G032770 · TK1151

Peroxisome0.079

Rank 5 · TkA01G032770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02729OTCace_N57-198 aa

PF00185OTCace204-354 aa

PF12662cEGF232-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G032770	`PF02729`	OTCace_N	57	198	1e-46	159.4
TkA01G032770	`PF00185`	OTCace	204	354	1.2e-57	195.1
TkA01G032770	`PF12662`	cEGF	232	244	0.3	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O50039`	Arabidopsis thaliana	sp\|O50039\|OTC_ARATH Ornithine transcarbamylase, chloroplastic	81.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card