LXL04_036119 | RubberDandelionOmics

Gene overview

LXL04_036119

Reference: OH-1004 Chr: Chr08 Coordinates: 36027081-36029357 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1590 bp · LXL04_036119|LXL04_036119|OH1004|cDNA

ATGGGAAACTGTTGCAGATCTCCGGCGGCGGTAGCCAGGGAGGATGTCAAGTCATCGAACTTTTCCGGACACGATCATACCAACAAGAAGGACAAGGCGAACGGGAAGAAGGCGCCGATCGATGTCTTGACTGATATATCCAAAGAAAATATTGAAGAGAAGTATATGGTGGATAGGGAACTTGGTCGCGGTGAATTTGGAGTTACTTACTTGTGTATAGATCGGAGCTCGAGGGAGTTGCTTGCTTGCAAGTCGATTTC...

CDS

Download CDS FASTA

1590 bp · LXL04_036119|LXL04_036119|OH1004|CDS

ATGGGAAACTGTTGCAGATCTCCGGCGGCGGTAGCCAGGGAGGATGTCAAGTCATCGAACTTTTCCGGACACGATCATACCAACAAGAAGGACAAGGCGAACGGGAAGAAGGCGCCGATCGATGTCTTGACTGATATATCCAAAGAAAATATTGAAGAGAAGTATATGGTGGATAGGGAACTTGGTCGCGGTGAATTTGGAGTTACTTACTTGTGTATAGATCGGAGCTCGAGGGAGTTGCTTGCTTGCAAGTCGATTTC...

Protein

Download Protein FASTA

529 aa · LXL04_036119|LXL04_036119|OH1004|PROTEIN

MGNCCRSPAAVAREDVKSSNFSGHDHTNKKDKANGKKAPIDVLTDISKENIEEKYMVDRELGRGEFGVTYLCIDRSSRELLACKSISKRKLRTAVDVDDVRREVAIMKHLPENSSIVTLREACEDENAVHLVMELCEGGELFDRIVARGHYTERAAAAVTRTMVEVVQLCHKHGVIHRDLKPENFLFANKKENSPLKAIDFGLSIFFKPGEKFSEIVGSPYYMAPEVLKRSYGPEIDIWSAGVILYILLCGVPPFWAESE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036119`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036119

Location Chr08:36027081-36029357 (+)

Description Similar to CPK13: Calcium-dependent protein kinase 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g51850`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g19450`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At5g12480`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0467000`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os01g0832300`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036119 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT3G51850

ath:AT5G12480

ath:AT5G19450

dosa:Os01g0832300

dosa:Os05g0467000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.556

Rank 1 · LXL04_036119 · OH-1004

Cytoplasm0.320

Rank 2 · LXL04_036119 · OH-1004

Nucleus0.216

Rank 3 · LXL04_036119 · OH-1004

Golgi apparatus0.063

Rank 4 · LXL04_036119 · OH-1004

Endoplasmic reticulum0.058

Rank 5 · LXL04_036119 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase55-313 aa

PF07714.24PK_Tyr_Ser-Thr57-308 aa

PF13499.13EF-hand_7359-419 aa

PF00036.39EF-hand_1360-388 aa

PF13405.13EF-hand_6360-388 aa

PF13202.13EF-hand_5361-383 aa

PF13833.13EF-hand_8373-420 aa

PF13499.13EF-hand_7431-494 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036119	`PF00069.32`	Pkinase	55	313	1.1e-75	255.1
LXL04_036119	`PF07714.24`	PK_Tyr_Ser-Thr	57	308	2.7e-23	83.3
LXL04_036119	`PF13499.13`	EF-hand_7	359	419	4.4e-27	94.9
LXL04_036119	`PF00036.39`	EF-hand_1	360	388	6.2e-28	95.0
LXL04_036119	`PF13405.13`	EF-hand_6	360	388	9.6e-24	81.5
LXL04_036119	`PF13202.13`	EF-hand_5	361	383	5e-24	83.3
LXL04_036119	`PF13833.13`	EF-hand_8	373	420	1.8e-14	53.9
LXL04_036119	`PF13499.13`	EF-hand_7	431	494	4.4e-27	94.9
LXL04_036119	`PF00036.39`	EF-hand_1	433	457	6.2e-28	95.0
LXL04_036119	`PF13405.13`	EF-hand_6	433	458	9.6e-24	81.5
LXL04_036119	`PF00036.39`	EF-hand_1	470	495	6.2e-28	95.0
LXL04_036119	`PF13833.13`	EF-hand_8	470	494	1.8e-14	53.9
LXL04_036119	`PF13202.13`	EF-hand_5	471	493	5e-24	83.3
LXL04_036119	`PF13405.13`	EF-hand_6	471	494	9.6e-24	81.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4I7`	Arabidopsis thaliana	Calcium-dependent protein kinase 13	85.849%	Swiss-Prot	strong database homology
`Q42438`	Arabidopsis thaliana	Calcium-dependent protein kinase 8	66.353%	Swiss-Prot	strong database homology
`Q38873`	Arabidopsis thaliana	Calcium-dependent protein kinase 7	65.478%	Swiss-Prot	strong database homology
`Q6I5I8`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 16	76.965%	Swiss-Prot	strong database homology
`Q8LPZ7`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 3	77.273%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card