LXL04_035394 | RubberDandelionOmics

Gene overview

LXL04_035394

Reference: OH-1004 Chr: Chr08 Coordinates: 21852850-21856028 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1080 bp · LXL04_035394|LXL04_035394|OH1004|cDNA

ATGCAGCAGCCACCGCCGCCGGCGTCCAAGCTTTCTCCCACTGCTATCACCACCGAGCAGATTCAAAAGTGCCTTGAAGACAACAAGAATTTAATTATGGCGATAATGGAAAATCAAAACCTTGGGAAGTTCCAGGAGTGTGCTCAGTACCAAGCTGTTCTTCAAAAGAACTTAATGTACTTGGCTGCCATTGCCGACACCCACCCACCTccaccaacaccaacaccaacaccaacaccaccaccaccacaacTACCAAA...

CDS

Download CDS FASTA

1080 bp · LXL04_035394|LXL04_035394|OH1004|CDS

ATGCAGCAGCCACCGCCGCCGGCGTCCAAGCTTTCTCCCACTGCTATCACCACCGAGCAGATTCAAAAGTGCCTTGAAGACAACAAGAATTTAATTATGGCGATAATGGAAAATCAAAACCTTGGGAAGTTCCAGGAGTGTGCTCAGTACCAAGCTGTTCTTCAAAAGAACTTAATGTACTTGGCTGCCATTGCCGACACCCACCCACCTCCACCAACACCAACACCAACACCAACACCACCACCACCACAACTACCAAA...

Protein

Download Protein FASTA

359 aa · LXL04_035394|LXL04_035394|OH1004|PROTEIN

MQQPPPPASKLSPTAITTEQIQKCLEDNKNLIMAIMENQNLGKFQECAQYQAVLQKNLMYLAAIADTHPPPPTPTPTPTPPPPQLPNQSQATPSLPPGFMPQQANNFMQQPQPGIPQLPGGGGGGGGQKLPFQLNSLRTQDQQQQLLQFQQQQQIQAQMGLRPGGQGGGLFGMHQVMNHGGDLVNGQGSKQDGSDVQNQFQSPFQPPFQPQFQTQPTPTEDVVYETQRESMSQSSRQKKGRKGKTTTAQDKVVPWTPEEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035394`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035394

Location Chr08:21852850-21856028 (-)

Description Similar to GIF3: GRF1-interacting factor 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00850`	Transcription coactivator that plays a role in the regulation of cell expansion in leaf and cotyledons tissues (By similarity).	The Arabidopsis GRF-INTERACTING FACTOR gene family performs an overlapping function in determining organ size as well as multiple developmental properties.2009 · DOI: 10.1104/pp.109.141838
`At1g01160`	Transcription coactivator that plays a role in the regulation of cell expansion in leaf and cotyledons tissues (By similarity).	The Arabidopsis GRF-INTERACTING FACTOR gene family performs an overlapping function in determining organ size as well as multiple developmental properties.2009 · DOI: 10.1104/pp.109.141838

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733600`	Transcription coactivator that plays a role in the regulation of meristematic function in leaves, stems and inflorescences.	The OsmiR396c-OsGRF4-OsGIF1 regulatory module determines grain size and yield in rice.2016 · DOI: 10.1111/pbi.12569 OsGIF1 Positively Regulates the Sizes of Stems, Leaves, and Grains in Rice.2017 · DOI: 10.3389/fpls.2017.01730 Conserved functional control, but distinct regulation, of cell proliferation in rice and Arabidopsis leaves revealed by comparative analysis of GRF-INTERACTING FACTOR 1 orthologs.2018 · DOI: 10.1242/dev.159624

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035394 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0045596 negative regulation of cell differentiation Biological Process

GO:0045787 positive regulation of cell cycle Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0048316 seed development Biological Process

KEGG gene cross-reference

ath:AT1G01160

ath:AT4G00850

dosa:Os03g0733600

hsa:6760

zma:100101544

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · LXL04_035394 · OH-1004

Cytoplasm0.102

Rank 2 · LXL04_035394 · OH-1004

Cell membrane0.016

Rank 3 · LXL04_035394 · OH-1004

Mitochondrion0.011

Rank 4 · LXL04_035394 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_035394 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05030.18SSXT15-68 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035394	`PF05030.18`	SSXT	15	68	8.2e-22	77.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93VH6`	Arabidopsis thaliana	GRF1-interacting factor 3	61.538%	Swiss-Prot	weak database homology
`Q9MAL9`	Arabidopsis thaliana	GRF1-interacting factor 2	75.806%	Swiss-Prot	weak database homology
`Q6AVI1`	Oryza sativa subsp. japonica	GRF-interacting factor 1	50.515%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card