Gene Card
Gene overview
cDNA / CDS / Protein Sequences
963 bp · LXL04_033519|LXL04_033519|OH1004|cDNA
ATGAGGTCCAGTTCAACTGGTCGGAGGCACACTCCAATTTTCCCCTTCCAAGGGTTTCTGGGGGAATGGTGCCGGATTCAATCTGTGTCCAAAGAAGATCGTGGTCTTGATATGCTTGGCGATCCTTCAAGCTCAGTGGCTATTGAACAAAATAGTGTTTCAGATGAAGCCTTAGCAGTCCAACATGCTGGATACCAGGAATATGCTGTCCAGCCAACAATAGATATAGCTGAAAAATTTAACGCTTTATGCCTCAAAGA...
888 bp · LXL04_033519|LXL04_033519|OH1004|CDS
ATGAGGTCCAGTTCAACTGGTCGGAGGCACACTCCAATTTTCCCCTTCCAAGGGTTTCTGGGGGAATGGTGCCGGATTCAATCTGTGTCCAAAGAAGATCGTGGTCTTGATATGCTTGGCGATCCTTCAAGCTCAGTGGCTATTGAACAAAATAGTGTTTCAGATGAAGCCTTAGCAGTCCAACATGCTGGATACCAGGAATATGCTGTCCAGCCAACAATAGATATAGCTGAAAAATTTAACGCTTTATGCCTCAAAGA...
Protein
Download Protein FASTA295 aa · LXL04_033519|LXL04_033519|OH1004|PROTEIN
MRSSSTGRRHTPIFPFQGFLGEWCRIQSVSKEDRGLDMLGDPSSSVAIEQNSVSDEALAVQHAGYQEYAVQPTIDIAEKFNALCLKDKGLLYEDPYIQIGITTQWKNHQGHLVLFLGNKNARVPLESIQAVILPPSHLKVELSLVSELISPKAQIQCEFEVVNVSPSSDVAVLDFSYKFQTYLVKILLRLPAVLNKFLYPIQVSDLEFFLTWRSLAGPPLRLQQLVRGVKPMSLLEMENLFDSLRMMVCPGLDPNPNNLI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_033519 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_033519 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:46090294-46092713 (+) | |||||||||
| Description | Similar to ALPHAC-AD: AP-2 complex subunit alpha-2 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006886 intracellular protein transport Biological Process GO:0006897 endocytosis Biological Process GO:0006971 hypotonic response Biological Process GO:0008104 intracellular protein localization Biological Process GO:0008356 asymmetric cell division Biological Process GO:0009992 intracellular water homeostasis Biological Process GO:0010508 positive regulation of autophagy Biological Process GO:0015031 protein transport Biological Process GO:0016192 vesicle-mediated transport Biological Process GO:0030100 regulation of endocytosis Biological Process GO:0031623 receptor internalization Biological Process GO:0038010 positive regulation of signal transduction by receptor internalization Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT5G22770 ath:AT5G22780 ddi:DDB_G0273439 ddi:DDB_G0273501 dme:Dmel_CG4260 dpo:4817178 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02883.27Alpha_adaptinC288-179 aaPF02296.23Alpha_adaptin_C196-293 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_033519 | PF02883.27 | Alpha_adaptinC2 | 88 | 179 | 4.6e-11 | 43.7 |
| LXL04_033519 | PF02296.23 | Alpha_adaptin_C | 196 | 293 | 5.5e-12 | 46.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.