LXL04_029900 | RubberDandelionOmics

Gene overview

LXL04_029900

Reference: OH-1004 Chr: Chr06 Coordinates: 103049089-103051117 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1311 bp · LXL04_029900|LXL04_029900|OH1004|cDNA

ATGAAAGCTTTAAGACTAATCCAAACACTTGCTaatcagtcttcaaaacccCTTAAAACCTCCAATCTCAATCCCACTTTTCTCTCTCGATTTTACGCATCCCAACCCCTACAAGAAAACCCAGTATCCGACACAGAAGAACCTCACACCACCAATACCAGTGCCTTCAGCTTCGACAGCAGCCATTACGAATTACCAAACTTGTCACTAGGTTTGGGCTTAGATGAGGCTGCAAATACTGAATCGAATTGGGACGAAAA...

CDS

Download CDS FASTA

1311 bp · LXL04_029900|LXL04_029900|OH1004|CDS

ATGAAAGCTTTAAGACTAATCCAAACACTTGCTAATCAGTCTTCAAAACCCCTTAAAACCTCCAATCTCAATCCCACTTTTCTCTCTCGATTTTACGCATCCCAACCCCTACAAGAAAACCCAGTATCCGACACAGAAGAACCTCACACCACCAATACCAGTGCCTTCAGCTTCGACAGCAGCCATTACGAATTACCAAACTTGTCACTAGGTTTGGGCTTAGATGAGGCTGCAAATACTGAATCGAATTGGGACGAAAA...

Protein

Download Protein FASTA

436 aa · LXL04_029900|LXL04_029900|OH1004|PROTEIN

MKALRLIQTLANQSSKPLKTSNLNPTFLSRFYASQPLQENPVSDTEEPHTTNTSAFSFDSSHYELPNLSLGLGLDEAANTESNWDEKYRRKANKTIFGEEHEKLVKDKKKKKSKNERMLEQEEKRRRTVILSKALLEAAVAPTDEEEDDDDDSEAVKMEDQLSLSVGIIGAPNAGKSALTNFMVGTKVAAVSRKTNTTTHEVLGVMTKGKTQICFFDTPGLIMKKYGLPKPDMKVRVESAWSSIDLYDILVVIFDVDRHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029900`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029900

Location Chr06:103049089-103051117 (+)

Description Similar to ERG: GTP-binding protein ERG

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30960`	Has a crucial role in plant growth and development, possibly by influencing mitochondrial division.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029900 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000028 ribosomal small subunit assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005525 GTP binding Molecular Function

GO:0019843 rRNA binding Molecular Function

GO:0043024 ribosomal small subunit binding Molecular Function

GO:0070181 small ribosomal subunit rRNA binding Molecular Function

GO:0097177 mitochondrial ribosome binding Molecular Function

KEGG gene cross-reference

ath:AT1G30960

bbt:BBta_4682

bra:BRADO4462

oca:OCAR_5843

ocg:OCA5_c21740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.837

Rank 1 · LXL04_029900 · OH-1004

Plastid0.114

Rank 2 · LXL04_029900 · OH-1004

Nucleus0.066

Rank 3 · LXL04_029900 · OH-1004

Cytoplasm0.041

Rank 4 · LXL04_029900 · OH-1004

Cell membrane0.015

Rank 5 · LXL04_029900 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926.30MMR_HSR1166-290 aa

PF07650.24KH_2363-430 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029900	`PF01926.30`	MMR_HSR1	166	290	2e-17	64.1
LXL04_029900	`PF07650.24`	KH_2	363	430	9.6e-10	38.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82653`	Arabidopsis thaliana	GTP-binding protein ERG	57.143%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card