LXL04_029850 | RubberDandelionOmics

Gene overview

LXL04_029850

Reference: OH-1004 Chr: Chr06 Coordinates: 101974756-101979245 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1026 bp · LXL04_029850|LXL04_029850|OH1004|cDNA

ATGGAGGAGAAATATGAGCCATTGCAAGAACTTGGTTCTGGAAACTTTGGAGTGGCAAGGTTGGTTAGAGATAAGAAGACTAAGGAGTTGCTTGCAGTCAAATACATTGAAAGAGGAACAAAGATCgatgaaaatgttaaaaggGAAATCATCAATCACAGATCACTCAAGCATCCAAACATCATTAGGTTCAAGGAGGTGTTATTAACCCCAACACATCTGGCTATAGTGATGGAATATGCAGCTGGTGGTGAACTTTT...

CDS

Download CDS FASTA

1026 bp · LXL04_029850|LXL04_029850|OH1004|CDS

ATGGAGGAGAAATATGAGCCATTGCAAGAACTTGGTTCTGGAAACTTTGGAGTGGCAAGGTTGGTTAGAGATAAGAAGACTAAGGAGTTGCTTGCAGTCAAATACATTGAAAGAGGAACAAAGATCGATGAAAATGTTAAAAGGGAAATCATCAATCACAGATCACTCAAGCATCCAAACATCATTAGGTTCAAGGAGGTGTTATTAACCCCAACACATCTGGCTATAGTGATGGAATATGCAGCTGGTGGTGAACTTTT...

Protein

Download Protein FASTA

341 aa · LXL04_029850|LXL04_029850|OH1004|PROTEIN

MEEKYEPLQELGSGNFGVARLVRDKKTKELLAVKYIERGTKIDENVKREIINHRSLKHPNIIRFKEVLLTPTHLAIVMEYAAGGELFIKICSAGRFSEDEARFFFQQLISGVSYCHSMEICHRDLKLENTLLDGSRSPRLKICDFGYSKSGLLHSQPKSTVGTPAYIAPEVLSRKEYDGKIADVWSCGVTLYVMLVGAYPFEDPRDPRNFRKTIGRIMSVQYSIPDYVRVSKDCRHLLSHIFVANPSKRITIGEIKKHPW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029850`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029850

Location Chr06:101974756-101979245 (-)

Description Similar to SAPK3: Serine/threonine-protein kinase SAPK3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0564500`	May play a role in signal transduction of hyperosmotic response.	No verified direct reference in this release
`UniProt: A2ZAB5`	May play a role in signal transduction of hyperosmotic response.	No verified direct reference in this release
`UniProt: A2YNT8`	May play a role in signal transduction of hyperosmotic response (By similarity).	No verified direct reference in this release
`Os07g0622000`	May play a role in signal transduction of hyperosmotic response (Probable).	A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth.2012 · DOI: 10.1093/jxb/err338

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029850 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0090351 seedling development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

dosa:Os07g0622000

dosa:Os10g0564500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.575

Rank 1 · LXL04_029850 · OH-1004

Nucleus0.463

Rank 2 · LXL04_029850 · OH-1004

Cell membrane0.173

Rank 3 · LXL04_029850 · OH-1004

Mitochondrion0.047

Rank 4 · LXL04_029850 · OH-1004

Endoplasmic reticulum0.047

Rank 5 · LXL04_029850 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase5-261 aa

PF07714.24PK_Tyr_Ser-Thr9-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029850	`PF00069.32`	Pkinase	5	261	6.4e-71	239.5
LXL04_029850	`PF07714.24`	PK_Tyr_Ser-Thr	9	257	6.2e-30	105.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C5D6`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase SAPK3	76.276%	Swiss-Prot	strong database homology
`A2ZAB5`	Oryza sativa subsp. indica	Serine/threonine-protein kinase SAPK3	76.276%	Swiss-Prot	strong database homology
`A2YNT8`	Oryza sativa subsp. indica	Serine/threonine-protein kinase SAPK2	73.731%	Swiss-Prot	strong database homology
`Q0D4J7`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase SAPK2	74.030%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card