RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_026582
Reference: OH-1004 Chr: Chr05 Coordinates: 128724612-128726934 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1740 bp · LXL04_026582|LXL04_026582|OH1004|cDNA

ATGGCTCTGCCGGAATCACAGGTGGCCAAAACTCTACCGGATGCTTGGGACTACAAAGGCAGGTCGGCAGCCCGTTCCAGCACCGGCGGCTGGTCTAGTGCCGCCATGATTCTAGGGGTGGAGGCTTGTGAGAGGCTAACGACGTTAGGTATCGCCGTTAATTTAGTGACGTACTTGACTGGTACTATGCATATTGGACAGGCTAACGCCGCTAACGACGTCACTAACTTCATGGGTACCTCTTTCATGTTATGCCTCCT...

CDS

Download CDS FASTA

1740 bp · LXL04_026582|LXL04_026582|OH1004|CDS

ATGGCTCTGCCGGAATCACAGGTGGCCAAAACTCTACCGGATGCTTGGGACTACAAAGGCAGGTCGGCAGCCCGTTCCAGCACCGGCGGCTGGTCTAGTGCCGCCATGATTCTAGGGGTGGAGGCTTGTGAGAGGCTAACGACGTTAGGTATCGCCGTTAATTTAGTGACGTACTTGACTGGTACTATGCATATTGGACAGGCTAACGCCGCTAACGACGTCACTAACTTCATGGGTACCTCTTTCATGTTATGCCTCCT...

Protein

Download Protein FASTA

579 aa · LXL04_026582|LXL04_026582|OH1004|PROTEIN

MALPESQVAKTLPDAWDYKGRSAARSSTGGWSSAAMILGVEACERLTTLGIAVNLVTYLTGTMHIGQANAANDVTNFMGTSFMLCLLGGFVADTFLGRYLTIAIFTAVQATGVTVLTISTAIPSLQPRKCSITGSSCIPASDFQLAVLYLALYLTALGTGGLKSSVSGFGSDQFDESNKEEKAQMTAFFNWFFFFISIGSLAAVTVLVYIQDNLGRRWGYGIVACSIGLGLVIFLSGTRRYRFKKLVGSPLTQIVSVFVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_026582
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_026582
LocationChr05:128724612-128726934 (-)
DescriptionSimilar to NPF6.3: Protein NRT1/ PTR FAMILY 6.3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g12110 Dual affinity nitrate transporter.
CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake.1999 · DOI: 10.1105/tpc.11.5.865
The nitrate transporter AtNRT1.1 (CHL1) functions in stomatal opening and contributes to drought susceptibility in Arabidopsis.2003 · DOI: 10.1105/tpc.006312
Switching between the two action modes of the dual-affinity nitrate transporter CHL1 by phosphorylation.2003 · DOI: 10.1093/emboj/cdg118
Transcript profiling in the chl1-5 mutant of Arabidopsis reveals a role of the nitrate transporter NRT1.1 in the regulation of another nitrate transporter, NRT2.1.2004 · DOI: 10.1105/tpc.104.024380
The Arabidopsis NRT1.1 transporter participates in the signaling pathway triggering root colonization of nitrate-rich patches.2006 · DOI: 10.1073/pnas.0605275103
A genetic screen for nitrate regulatory mutants captures the nitrate transporter gene NRT1.1.2009 · DOI: 10.1104/pp.109.140434
Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants.2010 · DOI: 10.1016/j.devcel.2010.05.008
The herbicide sensitivity gene CHL1 of Arabidopsis encodes a nitrate-inducible nitrate transporter.1993 · DOI: 10.1016/0092-8674(93)90399-b
The Arabidopsis CHL1 protein plays a major role in high-affinity nitrate uptake.1998 · DOI: 10.1073/pnas.95.25.15134
At2g26690 Low-affinity proton-dependent nitrate transporter. No verified direct reference in this release
At3g21670 Low-affinity nitrate transporter. No verified direct reference in this release
At3g54140 Peptide transporter.
AtPTR1, a plasma membrane peptide transporter expressed during seed germination and in vascular tissue of Arabidopsis.2004 · DOI: 10.1111/j.1365-313x.2004.02224.x
AtPTR1 and AtPTR5 transport dipeptides in planta.2008 · DOI: 10.1104/pp.108.123844
At5g01180 Peptide transporter.
AtPTR1 and AtPTR5 transport dipeptides in planta.2008 · DOI: 10.1104/pp.108.123844

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026582 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006857 oligopeptide transport Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009611 response to wounding Biological Process
GO:0009635 response to herbicide Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0009860 pollen tube growth Biological Process
GO:0010167 response to nitrate Biological Process
GO:0010540 basipetal auxin transport Biological Process
GO:0015031 protein transport Biological Process
GO:0015706 nitrate transmembrane transport Biological Process
GO:0042128 nitrate assimilation Biological Process
KEGG gene cross-reference
ath:AT1G12110
ath:AT2G26690
ath:AT3G21670
ath:AT3G54140
ath:AT5G01180
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.808
Rank 1 · LXL04_026582 · OH-1004
Cytoplasm0.076
Rank 2 · LXL04_026582 · OH-1004
Endoplasmic reticulum0.069
Rank 3 · LXL04_026582 · OH-1004
Lysosome / Vacuole0.057
Rank 4 · LXL04_026582 · OH-1004
Mitochondrion0.029
Rank 5 · LXL04_026582 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00854.28PTR299-516 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_026582PF00854.28PTR2995162.1e-111373.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q05085Arabidopsis thalianaProtein NRT1/ PTR FAMILY 6.363.761%Swiss-Protstrong database homology
Q9SZY4Arabidopsis thalianaProtein NRT1/ PTR FAMILY 6.256.627%Swiss-Protstrong database homology
Q9LVE0Arabidopsis thalianaProtein NRT1/ PTR FAMILY 6.449.830%Swiss-Protmoderate database homology
Q9M390Arabidopsis thalianaProtein NRT1/ PTR FAMILY 8.144.404%Swiss-Protmoderate database homology
Q9LFB8Arabidopsis thalianaProtein NRT1/ PTR FAMILY 8.244.043%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser