LXL04_025310 | RubberDandelionOmics

Gene overview

LXL04_025310

Reference: OH-1004 Chr: Chr05 Coordinates: 109519381-109520463 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1083 bp · LXL04_025310|LXL04_025310|OH1004|cDNA

ATGGACTCCCTTACCCTCGTCTGCACCGTCTCCCTTCTCGCCGGCGGCCTTTACTGGTTCGTCTGCATCCTTGGGTCCGCCGAACAGAAAGGCAAGCACGCCGTTCAGCTCTCTGGAGGCTCAATCGAACGTGATAATGTTCAAGACAATTACAACGAGTACTGGTCTTTCTTCCGCCGCCCCAAAGAGATCGAGAAGGCTGAAAATGTCCCGGCTTTCGTCGACACCTTTTATAACCTCGTCACGGATATCTACGAATG...

CDS

Download CDS FASTA

1083 bp · LXL04_025310|LXL04_025310|OH1004|CDS

ATGGACTCCCTTACCCTCGTCTGCACCGTCTCCCTTCTCGCCGGCGGCCTTTACTGGTTCGTCTGCATCCTTGGGTCCGCCGAACAGAAAGGCAAGCACGCCGTTCAGCTCTCTGGAGGCTCAATCGAACGTGATAATGTTCAAGACAATTACAACGAGTACTGGTCTTTCTTCCGCCGCCCCAAAGAGATCGAGAAGGCTGAAAATGTCCCGGCTTTCGTCGACACCTTTTATAACCTCGTCACGGATATCTACGAATG...

Protein

Download Protein FASTA

360 aa · LXL04_025310|LXL04_025310|OH1004|PROTEIN

MDSLTLVCTVSLLAGGLYWFVCILGSAEQKGKHAVQLSGGSIERDNVQDNYNEYWSFFRRPKEIEKAENVPAFVDTFYNLVTDIYEWGWGQSFHFSPAIPGKSNLESTRIHEEMAVDLIGVKPGQKILDAGCGVGGPMRAIAAHSGCNVVGITINEYQVSRAKAHNKKAGLDKLCDVVCGNFLEMPFEDNSFDGAYSIEATCHAPNLEDVYGEIFRVLKPGSMYVSYEWVTTELYRGEDPEHVEVIQGIERGDALPGLRS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025310`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025310

Location Chr05:109519381-109520463 (+)

Description Similar to SMT2: 24-methylenesterol C-methyltransferase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20330`	Catalyzes the methyl transfer from S-adenosyl-methionine to the methylene group of 24-methylene lophenol to form 24-ethylidene lophenol.	No verified direct reference in this release
`At1g76090`	Catalyzes the methyl transfer from S-adenosyl-methionine to the methylene group of 24-methylene lophenol to form 24-ethylidene lophenol.	No verified direct reference in this release
`At5g13710`	Catalyzes the methyl transfer from S-adenosyl-methionine to the C-24 of cycloartenol to form 24-methylene cycloartenol.	Sterol methyltransferase 1 controls the level of cholesterol in plants.2000 · DOI: 10.1105/tpc.12.6.853

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0136200`	Catalyzes the methyl transfer from S-adenosyl-methionine to the methylene group of 24-methylene lophenol to form 24-ethylidene lophenol.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025310 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006972 hyperosmotic response Biological Process

GO:0007389 pattern specification process Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0016126 sterol biosynthetic process Biological Process

GO:0032259 methylation Biological Process

GO:0032876 negative regulation of DNA endoreduplication Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G20330

ath:AT1G76090

ath:AT5G13710

ddi:DDB_G0288907

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.679

Rank 1 · LXL04_025310 · OH-1004

Mitochondrion0.164

Rank 2 · LXL04_025310 · OH-1004

Cytoplasm0.112

Rank 3 · LXL04_025310 · OH-1004

Cell membrane0.079

Rank 4 · LXL04_025310 · OH-1004

Nucleus0.076

Rank 5 · LXL04_025310 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02353.27CMAS74-281 aa

PF01209.25Ubie_methyltran108-230 aa

PF13847.13Methyltransf_31122-233 aa

PF13489.13Methyltransf_23122-277 aa

PF13649.13Methyltransf_25127-221 aa

PF08241.19Methyltransf_11128-224 aa

PF08242.19Methyltransf_12128-223 aa

PF29244.1Methyltransf_ANTKMT129-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025310	`PF02353.27`	CMAS	74	281	4.1e-14	53.3
LXL04_025310	`PF01209.25`	Ubie_methyltran	108	230	3.3e-11	43.7
LXL04_025310	`PF13847.13`	Methyltransf_31	122	233	3.3e-17	63.3
LXL04_025310	`PF13489.13`	Methyltransf_23	122	277	2.6e-09	37.7
LXL04_025310	`PF13649.13`	Methyltransf_25	127	221	4e-19	69.8
LXL04_025310	`PF08241.19`	Methyltransf_11	128	224	6e-23	82.0
LXL04_025310	`PF08242.19`	Methyltransf_12	128	223	1.2e-10	42.7
LXL04_025310	`PF29244.1`	Methyltransf_ANTKMT	129	229	2.5e-06	28.6
LXL04_025310	`PF08498.16`	Sterol_MT_C	291	355	2.5e-23	82.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39227`	Arabidopsis thaliana	24-methylenesterol C-methyltransferase 2	81.111%	Swiss-Prot	strong database homology
`Q94JS4`	Arabidopsis thaliana	24-methylenesterol C-methyltransferase 3	79.109%	Swiss-Prot	strong database homology
`Q9LM02`	Arabidopsis thaliana	Cycloartenol-C-24-methyltransferase	40.426%	Swiss-Prot	moderate database homology
`O82427`	Oryza sativa subsp. japonica	24-methylenesterol C-methyltransferase 2	69.916%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card