Gene Card
Gene overview
cDNA / CDS / Protein Sequences
663 bp · LXL04_023841|LXL04_023841|OH1004|cDNA
ATGCCTCTTACTCCTGATTTCGATTTTCTGATCAGTACACAAACATCTCCTCCTCTCCCGATTTCGATTTTCTGGTATGGAGTAATAGGCGACGGCGATATCTTCACATCATTCACTGATTTTACGGACCGGATTTTTAGAGAGGATTGTAAAACTGTGGACGTTAAAGGTTCTCATTCAGAGCACTTGGGAGATGAGATTCTCAACTTGAGGAATACATTGTTGCAGAGTGAACTGGAGAGGGAGAGAATAGCATTGGA...
663 bp · LXL04_023841|LXL04_023841|OH1004|CDS
ATGCCTCTTACTCCTGATTTCGATTTTCTGATCAGTACACAAACATCTCCTCCTCTCCCGATTTCGATTTTCTGGTATGGAGTAATAGGCGACGGCGATATCTTCACATCATTCACTGATTTTACGGACCGGATTTTTAGAGAGGATTGTAAAACTGTGGACGTTAAAGGTTCTCATTCAGAGCACTTGGGAGATGAGATTCTCAACTTGAGGAATACATTGTTGCAGAGTGAACTGGAGAGGGAGAGAATAGCATTGGA...
Protein
Download Protein FASTA220 aa · LXL04_023841|LXL04_023841|OH1004|PROTEIN
MPLTPDFDFLISTQTSPPLPISIFWYGVIGDGDIFTSFTDFTDRIFREDCKTVDVKGSHSEHLGDEILNLRNTLLQSELERERIALELEEEKKAQAERDKMLQESGELTEVKAEYEKLLMEFEAERTMNKIQIDNLTRRLADATSCLDEEPRVSYTSNSDISLTELEASIQVLEKALSLQNLESVVELETEKDKEASNKYEKLYMELMAAKEEACLEMLL
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_023841 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_023841 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr05:70500113-70501801 (-) | ||||||||||||
| Description | Similar to KIN7O: Kinesin-like protein KIN-7O | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000226 microtubule cytoskeleton organization Biological Process GO:0000278 mitotic cell cycle Biological Process GO:0007018 microtubule-based movement Biological Process GO:0008608 attachment of spindle microtubules to kinetochore Biological Process GO:0033044 regulation of chromosome organization Biological Process GO:0042327 positive regulation of phosphorylation Biological Process GO:0140694 membraneless organelle assembly Biological Process GO:1901987 regulation of cell cycle phase transition Biological Process GO:0000776 kinetochore Cellular Component GO:0000779 condensed chromosome, centromeric region Cellular Component GO:0005635 nuclear envelope Cellular Component GO:0005694 chromosome Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT3G10180 dosa:Os09g0421200 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.