LXL04_021490 | RubberDandelionOmics

Gene overview

LXL04_021490

Reference: OH-1004 Chr: Chr04 Coordinates: 131113982-131116282 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · LXL04_021490|LXL04_021490|OH1004|cDNA

ATGGCAGGTGGAAAATGGTGGTGCTTCGGTAATCGGAGCTCCGGCGACGACGTCTCTGATCTTGACCCGATTCTTCTGGTGAGTGGCGTTGGCGGTACTATTCTGAATTCGAAGCCAAAGAGCTGGTTCGGGCTCACAACCCGTGTTTGGGTCCGAATCCTTCTTGCTGATATGGAGTTCCGAAAGAGAGTCTGGTCCCTGTACAATCCCGACACTGGGTACACGGAAGCATTGGATGATAGTTCCGATATTGTGGTTCC...

CDS

Download CDS FASTA

1338 bp · LXL04_021490|LXL04_021490|OH1004|CDS

ATGGCAGGTGGAAAATGGTGGTGCTTCGGTAATCGGAGCTCCGGCGACGACGTCTCTGATCTTGACCCGATTCTTCTGGTGAGTGGCGTTGGCGGTACTATTCTGAATTCGAAGCCAAAGAGCTGGTTCGGGCTCACAACCCGTGTTTGGGTCCGAATCCTTCTTGCTGATATGGAGTTCCGAAAGAGAGTCTGGTCCCTGTACAATCCCGACACTGGGTACACGGAAGCATTGGATGATAGTTCCGATATTGTGGTTCC...

Protein

Download Protein FASTA

445 aa · LXL04_021490|LXL04_021490|OH1004|PROTEIN

MAGGKWWCFGNRSSGDDVSDLDPILLVSGVGGTILNSKPKSWFGLTTRVWVRILLADMEFRKRVWSLYNPDTGYTEALDDSSDIVVPQDDYGLYAIDILDPSYLIKCLHVTDVYHFHDMIDMLIKCGYKKGTTLFGYGYDFRQSNRIDQNMEGLKEKLETAYKASGGKKINLISHSMGGLLVSCFIALHSDVFSKYVKKWITIATPFQGAPGCINDSLLTGLQFVEGLESYFFVSRWSMHQLLVECPSIYEMLPNPEFQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021490`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021490

Location Chr04:131113982-131116282 (+)

Description Similar to LCAT3: Phospholipase A(1) LCAT3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03310`	Hydrolyzes the sn-1 acylester bond of phospholipids.	Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana.2004 · DOI: 10.1111/j.1432-1033.2004.04317.x
`At4g19860`	Lecithin-cholesterol acyltransferase-like 4.	No verified direct reference in this release
`At1g27480`	Lecithin-cholesterol acyltransferase-like 1.	No verified direct reference in this release
`At3g44830`	Putative phospholipid:diacylglycerol acyltransferase 2.	No verified direct reference in this release
`At5g13640`	Triacylglycerol formation by an acyl-CoA independent pathway.	Cloning and functional characterization of a phospholipid:diacylglycerol acyltransferase from Arabidopsis.2004 · DOI: 10.1104/pp.104.044354 DGAT1 and PDAT1 acyltransferases have overlapping functions in Arabidopsis triacylglycerol biosynthesis and are essential for normal pollen and seed development.2009 · DOI: 10.1105/tpc.109.071795 DGAT1, DGAT2 and PDAT expression in seeds and other tissues of epoxy and hydroxy fatty acid accumulating plants.2010 · DOI: 10.1007/s11745-010-3385-4

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021490 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006071 glycerol metabolic process Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0009395 phospholipid catabolic process Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G27480

ath:AT3G03310

ath:AT3G44830

ath:AT4G19860

ath:AT5G13640

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.269

Rank 1 · LXL04_021490 · OH-1004

Lysosome / Vacuole0.268

Rank 2 · LXL04_021490 · OH-1004

Cytoplasm0.250

Rank 3 · LXL04_021490 · OH-1004

Golgi apparatus0.133

Rank 4 · LXL04_021490 · OH-1004

Cell membrane0.126

Rank 5 · LXL04_021490 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02450.22LCAT79-390 aa

PF05057.22DUF676158-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021490	`PF02450.22`	LCAT	79	390	2.1e-29	103.7
LXL04_021490	`PF05057.22`	DUF676	158	230	5.1e-06	26.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93V61`	Arabidopsis thaliana	Phospholipase A(1) LCAT3	65.455%	Swiss-Prot	strong database homology
`Q71N54`	Arabidopsis thaliana	Lecithin-cholesterol acyltransferase-like 4	51.456%	Swiss-Prot	strong database homology
`Q9FZI8`	Arabidopsis thaliana	Lecithin-cholesterol acyltransferase-like 1	24.107%	Swiss-Prot	weak database homology
`Q9FYC7`	Arabidopsis thaliana	Putative phospholipid:diacylglycerol acyltransferase 2	26.471%	Swiss-Prot	weak database homology
`Q9FNA9`	Arabidopsis thaliana	Phospholipid:diacylglycerol acyltransferase 1	24.870%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card