LXL04_015816 | RubberDandelionOmics

Gene overview

LXL04_015816

Reference: OH-1004 Chr: Chr03 Coordinates: 87055315-87063638 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6108 bp · LXL04_015816|LXL04_015816|OH1004|cDNA

ATGAGTAGTAGACTTCAAAACCCATTTGTTGCGGCAGATTTCCAATCCTCCTTGAAGCCAAAAAACATAAACGGTTTGGGTTATCTCGGCAACAAATTCCCCAGAAAATCTCGTTATGATATCATTCCACGTGCCAAAAAAAACGACTGGATATCTCATGGGATTAGGTTTTCACAATCATGCGGGGAAAATGTTGAGATCTTATGGAAGAATATAGGATTAAGAAGTGGTTTTGTGGTGAAATCCGTGAAAGAACCTTT...

CDS

Download CDS FASTA

6108 bp · LXL04_015816|LXL04_015816|OH1004|CDS

ATGAGTAGTAGACTTCAAAACCCATTTGTTGCGGCAGATTTCCAATCCTCCTTGAAGCCAAAAAACATAAACGGTTTGGGTTATCTCGGCAACAAATTCCCCAGAAAATCTCGTTATGATATCATTCCACGTGCCAAAAAAAACGACTGGATATCTCATGGGATTAGGTTTTCACAATCATGCGGGGAAAATGTTGAGATCTTATGGAAGAATATAGGATTAAGAAGTGGTTTTGTGGTGAAATCCGTGAAAGAACCTTT...

Protein

Download Protein FASTA

2035 aa · LXL04_015816|LXL04_015816|OH1004|PROTEIN

MSSRLQNPFVAADFQSSLKPKNINGLGYLGNKFPRKSRYDIIPRAKKNDWISHGIRFSQSCGENVEILWKNIGLRSGFVVKSVKEPFTRSKAIVRSLSTVWEEGLLLFRCSVFCAVISGVCLLLWYGQLKAKTLIEAKLLPSVCTALSDYIQRDLHFGKVRSVSPLSITLESCSIGPHKEEFSCGEVPTLKLRVHPFSSLRTGKIVVDAVLSNPTLLVSQKRNYSWLGIPFSDGVLQKHLSTEEGIDSRTKTRRIAREQT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015816`
TK1151 ID	TkA02G209120
OH-1004 ID	LXL04_015816
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015816

Location Chr03:87055315-87063638 (-)

Description Similar to TIC236: Protein TIC236, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g25660`	Part of the inner chloroplast membrane translocon complex (TIC) which associates with the outer chloroplast membrane translocon complex (TOC) and forms a supercomplex involved in protein precursor import into the chloroplast stroma.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0179400`	Part of the inner chloroplast membrane translocon complex (TIC) which associates with the outer chloroplast membrane translocon complex (TOC) and forms a supercomplex involved in protein precursor import into the chloroplast stroma (By similarity).	Amyloplast-localized SUBSTANDARD STARCH GRAIN4 protein influences the size of starch grains in rice endosperm.2014 · DOI: 10.1104/pp.113.229591

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015816 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009306 protein secretion Biological Process

GO:0009660 amyloplast organization Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0031972 chloroplast intermembrane space Cellular Component

KEGG gene cross-reference

ath:AT2G25660

dosa:Os01g0179400

osa:4323878

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.673

Rank 1 · LXL04_015816 · OH-1004

Mitochondrion0.151

Rank 2 · LXL04_015816 · OH-1004

Cytoplasm0.091

Rank 3 · LXL04_015816 · OH-1004

Nucleus0.088

Rank 4 · LXL04_015816 · OH-1004

Endoplasmic reticulum0.076

Rank 5 · LXL04_015816 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04357.20TamB1623-2018 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015816	`PF04357.20`	TamB	1623	2018	6.4e-18	65.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4ISL7`	Arabidopsis thaliana	Protein TIC236, chloroplastic	71.509%	Swiss-Prot	strong database homology
`W0RYD3`	Oryza sativa subsp. japonica	Protein SUBSTANDARD STARCH GRAIN 4, chloroplastic	64.783%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card